Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001591.1

Orthogroup ID

OG0017751

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 691

Gene Structure 691 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001591.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 605 bp

atggttgatctccttggctgggccggtttgctttccgaagcctatgaatttgtagagaaaatgccaataaggccaaattctgtgatttggaggacccttctcggagcatgtgtaaatcataacaatcttgtgttggctaagaaagtgaagaagaggttgaacaagctagattgttatcatgatggtgattatgtgcttttatctgatgttaggaattcaatgagggcaaggagagttaacaagaaagctggttctagttcaattagtgtagaccaaatcattcatgagttcatttcaggggataactctcatccccaatcactggatattagagatttcttagacagaatatttgaaagtataaaagacacgggatatactccccttacatcgaatgtattgcatgacattgaagaggaggagaaggagcatactcttcgttatcatagtgagaaattggctgtggcttttgcacttctgagtgtcaaggatactaggaccattagggtcatgcagaatattcgaatctgttgtgactgccattctttcatgaagcatgtttcagccaaatttggtagagaaattattgttcgccatcgaaatcg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

202

Amino Acids

23.32

Weight (kDa)

8.97

Isoelectric Point (pI)

39.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017751)

Species	Orthologous Gene IDs
prunus_persica	Prupe.4G088400_v2.0.a1
rosa_chinensis	RchiOBHm_Chr5g0015391 RchiOBHm_Chr5g0015401
rosa_multiflora	Rmu_sc0001591.1_g000001 Rmu_sc0001591.1_g000002 Rmu_sc0007708.1_g000003
rosa_rugosa	Rorug05G0027100 Rorug05G0027200
rosa_samantha	Rh5BG119600 Rh5CG130200 Rh5CG130300 Rh5DG118700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	322
AccI	GTMKAC	1 cut(s)	270
AcsI	RAATTY	4 cut(s)	47, 76, 214, 569
AfiI	CCNNNNNNNGG	2 cut(s)	19, 322
AgsI	TTSAA	5 cut(s)	160, 219, 261, 356, 413
AluBI	AGCT	2 cut(s)	166, 248
AluI	AGCT	2 cut(s)	166, 248
AoxI	GGCC	2 cut(s)	21, 71
ApoI	RAATTY	4 cut(s)	47, 76, 214, 569
ArsI	GACNNNNNNTTYG	2 cut(s)	335, 367
AspS9I	GGNCC	3 cut(s)	21, 93, 498
AsuHPI	GGTGA	1 cut(s)	197
AsuII	TTCGAA	1 cut(s)	523
AvaII	GGWCC	2 cut(s)	93, 498
BccI	CCATC	2 cut(s)	176, 603
BcgI	CGANNNNNNTGC	6 cut(s)	382, 416, 419, 453, 503, 537
BciVI	GTATCC	1 cut(s)	484
BfaI	CTAG	3 cut(s)	167, 255, 495
BfuI	GTATCC	1 cut(s)	484
BglI	GCCNNNNNGGC	1 cut(s)	70
Bme18I	GGWCC	2 cut(s)	93, 498
BmgT120I	GGNCC	3 cut(s)	21, 93, 498
BmiI	GGNNCC	1 cut(s)	95
Bpu14I	TTCGAA	1 cut(s)	523
BsaBI	GATNNNNATC	1 cut(s)	174
BsaJI	CCNNGG	1 cut(s)	13
BsaXI	ACNNNNNCTCC	2 cut(s)	96, 126
Bsc4I	CCNNNNNNNGG	2 cut(s)	19, 322
Bse118I	RCCGGY	1 cut(s)	23
Bse1I	ACTGG	1 cut(s)	327
Bse8I	GATNNNNATC	1 cut(s)	174
BseDI	CCNNGG	1 cut(s)	13
BseGI	GGATG	1 cut(s)	310
BseJI	GATNNNNATC	1 cut(s)	174
BseLI	CCNNNNNNNGG	2 cut(s)	19, 322
BseMII	CTCAG	1 cut(s)	470
BseNI	ACTGG	1 cut(s)	327
BseRI	GAGGAG	2 cut(s)	431, 434
BseYI	CCCAGC	1 cut(s)	18
BshFI	GGCC	2 cut(s)	23, 73
BsiSI	CCGG	1 cut(s)	24
BslI	CCNNNNNNNGG	2 cut(s)	19, 322
BsnI	GGCC	2 cut(s)	23, 73
Bsp119I	TTCGAA	1 cut(s)	523
Bsp143I	GATC	1 cut(s)	7
BspANI	GGCC	2 cut(s)	23, 73
BspCNI	CTCAG	1 cut(s)	471
BspHI	TCATGA	3 cut(s)	178, 283, 549
BspLI	GGNNCC	1 cut(s)	95
BspT104I	TTCGAA	1 cut(s)	523
BsrFI	RCCGGY	1 cut(s)	23
BsrI	ACTGG	1 cut(s)	327
BssAI	RCCGGY	1 cut(s)	23
BssECI	CCNNGG	1 cut(s)	13
BssMI	GATC	1 cut(s)	7
BssT1I	CCWWGG	1 cut(s)	13
Bst6I	CTCTTC	3 cut(s)	146, 408, 441
BstBI	TTCGAA	1 cut(s)	523
BstDEI	CTNAG	3 cut(s)	138, 340, 479
BstF5I	GGATG	1 cut(s)	310
BstKTI	GATC	1 cut(s)	10
BstMBI	GATC	1 cut(s)	7
BstMWI	GCNNNNNNNGC	1 cut(s)	70
BstNSI	RCATGY	2 cut(s)	111, 560
BsuI	GTATCC	1 cut(s)	484
BsuRI	GGCC	2 cut(s)	23, 73
BtsCI	GGATG	1 cut(s)	310
BtsIMutI	CAGTG	1 cut(s)	320
CciI	TCATGA	3 cut(s)	178, 283, 549
Cfr10I	RCCGGY	1 cut(s)	23
Cfr13I	GGNCC	3 cut(s)	21, 93, 498
CviAII	CATG	7 cut(s)	108, 179, 284, 404, 511, 550, 557
DdeI	CTNAG	3 cut(s)	138, 340, 479
DpnI	GATC	1 cut(s)	9
DpnII	GATC	1 cut(s)	7
Eam1104I	CTCTTC	3 cut(s)	146, 408, 441
EarI	CTCTTC	3 cut(s)	146, 408, 441
Eco130I	CCWWGG	1 cut(s)	13
Eco47I	GGWCC	2 cut(s)	93, 498
EcoO109I	RGGNCCY	1 cut(s)	93
EcoRI	GAATTC	1 cut(s)	214
EcoT14I	CCWWGG	1 cut(s)	13
ErhI	CCWWGG	1 cut(s)	13
FaeI	CATG	7 cut(s)	111, 182, 287, 407, 514, 553, 560
FatI	CATG	7 cut(s)	107, 178, 283, 403, 510, 549, 556
FblI	GTMKAC	1 cut(s)	270
FokI	GGATG	1 cut(s)	297
FspBI	CTAG	3 cut(s)	167, 255, 495
GsaI	CCCAGC	1 cut(s)	22
HaeIII	GGCC	2 cut(s)	23, 73
HapII	CCGG	1 cut(s)	24
Hin1II	CATG	7 cut(s)	111, 182, 287, 407, 514, 553, 560
HincII	GTYRAC	1 cut(s)	238
HindII	GTYRAC	1 cut(s)	238
HinfI	GANTC	1 cut(s)	525
HpaI	GTTAAC	1 cut(s)	238
HpaII	CCGG	1 cut(s)	24
HphI	GGTGA	1 cut(s)	197
Hpy166II	GTNNAC	2 cut(s)	238, 271
Hpy188I	TCNGA	4 cut(s)	37, 104, 205, 480
Hpy188III	TCNNGA	3 cut(s)	179, 284, 550
Hpy8I	GTNNAC	2 cut(s)	238, 271
HpyAV	CCTTC	2 cut(s)	107, 418
HpyCH4V	TGCA	3 cut(s)	403, 473, 514
HpyF10VI	GCNNNNNNNGC	1 cut(s)	70
HpyF3I	CTNAG	3 cut(s)	138, 340, 479
Hsp92II	CATG	7 cut(s)	111, 182, 287, 407, 514, 553, 560
KspAI	GTTAAC	1 cut(s)	238
Kzo9I	GATC	1 cut(s)	7
LmnI	GCTCC	2 cut(s)	104, 427
LpnPI	CCDG	5 cut(s)	4, 37, 234, 282, 308
MaeI	CTAG	3 cut(s)	167, 255, 495
MaeIII	GTNAC	1 cut(s)	533
MalI	GATC	1 cut(s)	9
MboI	GATC	1 cut(s)	7
MboII	GAAGA	4 cut(s)	160, 163, 425, 428
MluCI	AATT	7 cut(s)	47, 76, 214, 261, 455, 569, 582
MnlI	CCTC	5 cut(s)	84, 147, 216, 409, 412
MseI	TTAA	1 cut(s)	237
MslI	CAYNNNNRTG	1 cut(s)	183
MspI	CCGG	1 cut(s)	24
MwoI	GCNNNNNNNGC	1 cut(s)	70
NdeII	GATC	1 cut(s)	7
NlaIII	CATG	7 cut(s)	111, 182, 287, 407, 514, 553, 560
NlaIV	GGNNCC	1 cut(s)	95
NmuCI	GTSAC	1 cut(s)	533
NspI	RCATGY	2 cut(s)	111, 560
NspV	TTCGAA	1 cut(s)	523
PagI	TCATGA	3 cut(s)	178, 283, 549
PfeI	GAWTC	1 cut(s)	525
PflMI	CCANNNNNTGG	1 cut(s)	322
PpuMI	RGGWCCY	1 cut(s)	93
Psp5II	RGGWCCY	1 cut(s)	93
PspFI	CCCAGC	1 cut(s)	18
PspN4I	GGNNCC	1 cut(s)	95
PspPI	GGNCC	3 cut(s)	21, 93, 498
PspPPI	RGGWCCY	1 cut(s)	93
RseI	CAYNNNNRTG	1 cut(s)	183
SaqAI	TTAA	1 cut(s)	237
Sau3AI	GATC	1 cut(s)	7
Sau96I	GGNCC	3 cut(s)	21, 93, 498
SetI	ASST	3 cut(s)	158, 168, 250
SfuI	TTCGAA	1 cut(s)	523
SinI	GGWCC	2 cut(s)	93, 498
SmiMI	CAYNNNNRTG	1 cut(s)	183
Sse9I	AATT	7 cut(s)	47, 76, 214, 261, 455, 569, 582
SspI	AATATT	2 cut(s)	351, 520
SspMI	CTAG	3 cut(s)	167, 255, 495
StyI	CCWWGG	1 cut(s)	13
TaqI	TCGA	3 cut(s)	392, 523, 598
TasI	AATT	7 cut(s)	47, 76, 214, 261, 455, 569, 582
TfiI	GAWTC	1 cut(s)	525
Tru1I	TTAA	1 cut(s)	237
Tru9I	TTAA	1 cut(s)	237
TscAI	CASTG	1 cut(s)	327
TseFI	GTSAC	1 cut(s)	533
Tsp45I	GTSAC	1 cut(s)	533
TspDTI	ATGAA	5 cut(s)	60, 272, 280, 538, 566
TspRI	CASTG	1 cut(s)	327
Van91I	CCANNNNNTGG	1 cut(s)	322
VpaK11BI	GGWCC	2 cut(s)	93, 498
XapI	RAATTY	4 cut(s)	47, 76, 214, 569
XceI	RCATGY	2 cut(s)	111, 560
XmiI	GTMKAC	1 cut(s)	270
XspI	CTAG	3 cut(s)	167, 255, 495

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.