Rmu_sc0007708.1_g000003

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007708.1
Physical Location & Seq
Reverse (-)
3889 .. 5001
1113 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007708.1_g000003.1.cds

Sequence Viewer

Length: 1113 bp
atgcagcttgccaagaatgtaatgctagatgaggtcagtatgcttagtgtgatatccgctgtttcgagcttaggggcactggaattgggtcagtgggttcatgactttataaacaaaagtcaactaaaacttaccgtatcattgggtactgcattgatcgacatgtattcgcgttgtggatctgtcgataaatctattgaaattcttgatgaaatgtcattgaagaatgtacagacatggacaacattgagtactggccttgctgtgcatggctgcagtagagaagcactaagggtcttttatgagatgaaaaaagctggcttgcagccagatcatatgtctataactgggattttaatggcatgtagtcatggtggacttgtggaagatgattggagagttttcaaaagcatgaagaatgagtatggcctggagccaaggcttgagcattatggttgtatggttgacctccttggccgggccggtttgctttccgaagcctatgaatttgtagagaaaatgccaataaggccaaattctgtgatttggaggacccttcttggagcatgtgtaaatcataacaatcttgtgttggctaagaaagtgaagaagaggttgaacaagctagatcgttatcatgatggtgattatgtgcttttatctgatgttaggaattcaatgagggcaaggagagttaacaagaaagctggttctagttcaattagtgtagaccaaatcattcatgagttcatttcaggggagaactctcatccccaatcactggatattagagatttcttagacagaatatttgaaagtataaaagacacgggatatactccccttacatcgaatgtattgcatgacattgaagaggaggagaaggagcatactcttcgttatcatagtgagaaattggctgtggcttttgcacttctgagtgtcaaggatactaggaccattagggtcatgcagaatattcgaatctgttgtgactgccattctttcatgaagcatgtttcagccaaatttggtagagaaattattgttcgccatcgaaatcggttctatcattttatcaatggatcatgttcttgtcaagattattggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

370

Amino Acids

42.18

Weight (kDa)

8.0

Isoelectric Point (pI)

38.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 110
AccB7I CCANNNNNTGG 1 cut(s) 781
AccI GTMKAC 1 cut(s) 729
AccII CGCG 1 cut(s) 172
AciI CCGC 1 cut(s) 57
AclWI GGATC 2 cut(s) 187, 1093
AcoI YGGCCR 1 cut(s) 475
AcsI RAATTY 5 cut(s) 201, 506, 535, 673, 1028
AfaI GTAC 3 cut(s) 148, 231, 253
AfiI CCNNNNNNNGG 2 cut(s) 478, 781
AflIII ACRYGT 1 cut(s) 162
AgsI TTSAA 8 cut(s) 200, 223, 406, 619, 678, 720, 815, 872
AjnI CCWGG 1 cut(s) 429
AluBI AGCT 5 cut(s) 7, 69, 317, 625, 707
AluI AGCT 5 cut(s) 7, 69, 317, 625, 707
AlwI GGATC 2 cut(s) 187, 1093
AoxI GGCC 5 cut(s) 256, 427, 475, 480, 530
ApeKI GCWGC 3 cut(s) 4, 273, 325
ApoI RAATTY 5 cut(s) 201, 506, 535, 673, 1028
ArsI GACNNNNNNTTYG 2 cut(s) 794, 826
AspS9I GGNCC 3 cut(s) 480, 552, 957
AsuC2I CCSGG 1 cut(s) 479
AsuHPI GGTGA 1 cut(s) 656
AsuII TTCGAA 1 cut(s) 982
AvaII GGWCC 2 cut(s) 552, 957
BaeGI GKGCMC 1 cut(s) 79
BbvI GCAGC 3 cut(s) 16, 260, 337
BccI CCATC 2 cut(s) 635, 1062
BcgI CGANNNNNNTGC 6 cut(s) 841, 875, 878, 912, 962, 996
BciT130I CCWGG 1 cut(s) 431
BciVI GTATCC 1 cut(s) 943
BcnI CCSGG 1 cut(s) 479
BfaI CTAG 4 cut(s) 26, 626, 714, 954
BfmI CTRYAG 1 cut(s) 274
BfuI GTATCC 1 cut(s) 943
BglI GCCNNNNNGGC 1 cut(s) 529
BisI GCNGC 3 cut(s) 5, 274, 326
BlsI GCNGC 3 cut(s) 6, 275, 327
BmcAI AGTACT 1 cut(s) 253
Bme1390I CCNGG 2 cut(s) 431, 479
Bme18I GGWCC 2 cut(s) 552, 957
BmgT120I GGNCC 3 cut(s) 480, 552, 957
BmiI GGNNCC 2 cut(s) 435, 554
BmrFI CCNGG 2 cut(s) 431, 479
BmrI ACTGGG 1 cut(s) 357
BmuI ACTGGG 1 cut(s) 357
BpmI CTGGAG 1 cut(s) 452
Bpu10I CCTNAGC 1 cut(s) 70
Bpu14I TTCGAA 1 cut(s) 982
BpuEI CTTGAG 1 cut(s) 464
BpuMI CCSGG 1 cut(s) 479
BsaBI GATNNNNATC 1 cut(s) 633
BsaJI CCNNGG 2 cut(s) 437, 472
BsaXI ACNNNNNCTCC 2 cut(s) 555, 585
Bsc4I CCNNNNNNNGG 2 cut(s) 478, 781
Bse118I RCCGGY 1 cut(s) 482
Bse1I ACTGG 4 cut(s) 84, 259, 352, 786
Bse8I GATNNNNATC 1 cut(s) 633
BseBI CCWGG 1 cut(s) 431
BseDI CCNNGG 2 cut(s) 437, 472
BseGI GGATG 1 cut(s) 769
BseJI GATNNNNATC 1 cut(s) 633
BseLI CCNNNNNNNGG 2 cut(s) 478, 781
BseMII CTCAG 1 cut(s) 929
BseNI ACTGG 4 cut(s) 84, 259, 352, 786
BseRI GAGGAG 2 cut(s) 890, 893
BseSI GKGCMC 1 cut(s) 79
BseXI GCAGC 3 cut(s) 16, 260, 337
Bsh1236I CGCG 1 cut(s) 172
BshFI GGCC 5 cut(s) 258, 429, 477, 482, 532
BsiSI CCGG 2 cut(s) 478, 483
BslI CCNNNNNNNGG 2 cut(s) 478, 781
BsnI GGCC 5 cut(s) 258, 429, 477, 482, 532
Bsp119I TTCGAA 1 cut(s) 982
Bsp1286I GDGCHC 1 cut(s) 79
Bsp1407I TGTACA 1 cut(s) 229
Bsp143I GATC 5 cut(s) 156, 179, 331, 628, 1085
BspACI CCGC 1 cut(s) 57
BspANI GGCC 5 cut(s) 258, 429, 477, 482, 532
BspCNI CTCAG 1 cut(s) 930
BspFNI CGCG 1 cut(s) 172
BspHI TCATGA 4 cut(s) 100, 637, 742, 1008
BspLI GGNNCC 2 cut(s) 435, 554
BspMAI CTGCAG 1 cut(s) 278
BspPI GGATC 2 cut(s) 187, 1093
BspT104I TTCGAA 1 cut(s) 982
BsrFI RCCGGY 1 cut(s) 482
BsrGI TGTACA 1 cut(s) 229
BsrI ACTGG 4 cut(s) 84, 259, 352, 786
BssAI RCCGGY 1 cut(s) 482
BssECI CCNNGG 2 cut(s) 437, 472
BssMI GATC 5 cut(s) 156, 179, 331, 628, 1085
BssT1I CCWWGG 2 cut(s) 437, 472
Bst2UI CCWGG 1 cut(s) 431
Bst4CI ACNGT 1 cut(s) 136
Bst6I CTCTTC 3 cut(s) 605, 867, 900
BstAUI TGTACA 1 cut(s) 229
BstBI TTCGAA 1 cut(s) 982
BstC8I GCNNGC 3 cut(s) 9, 319, 323
BstDEI CTNAG 6 cut(s) 44, 70, 290, 597, 799, 938
BstF5I GGATG 1 cut(s) 769
BstFNI CGCG 1 cut(s) 172
BstKTI GATC 5 cut(s) 159, 182, 334, 631, 1088
BstMBI GATC 5 cut(s) 156, 179, 331, 628, 1085
BstMWI GCNNNNNNNGC 1 cut(s) 529
BstNI CCWGG 1 cut(s) 431
BstNSI RCATGY 4 cut(s) 166, 366, 570, 1019
BstSCI CCNGG 2 cut(s) 429, 477
BstSFI CTRYAG 1 cut(s) 274
BstSLI GKGCMC 1 cut(s) 79
BstUI CGCG 1 cut(s) 172
BstV1I GCAGC 3 cut(s) 16, 260, 337
BstX2I RGATCY 1 cut(s) 179
BstYI RGATCY 1 cut(s) 179
BsuI GTATCC 1 cut(s) 943
BsuRI GGCC 5 cut(s) 258, 429, 477, 482, 532
BtsCI GGATG 1 cut(s) 769
BtsIMutI CAGTG 3 cut(s) 77, 98, 779
Cac8I GCNNGC 3 cut(s) 9, 319, 323
CciI TCATGA 4 cut(s) 100, 637, 742, 1008
Cfr10I RCCGGY 1 cut(s) 482
Cfr13I GGNCC 3 cut(s) 480, 552, 957
Csp6I GTAC 3 cut(s) 147, 230, 252
CviQI GTAC 3 cut(s) 147, 230, 252
DdeI CTNAG 6 cut(s) 44, 70, 290, 597, 799, 938
DpnI GATC 5 cut(s) 158, 181, 333, 630, 1087
DpnII GATC 5 cut(s) 156, 179, 331, 628, 1085
EaeI YGGCCR 1 cut(s) 475
Eam1104I CTCTTC 3 cut(s) 605, 867, 900
EarI CTCTTC 3 cut(s) 605, 867, 900
Eco130I CCWWGG 2 cut(s) 437, 472
Eco32I GATATC 1 cut(s) 54
Eco47I GGWCC 2 cut(s) 552, 957
EcoO109I RGGNCCY 1 cut(s) 552
EcoRI GAATTC 1 cut(s) 673
EcoRII CCWGG 1 cut(s) 429
EcoRV GATATC 1 cut(s) 54
EcoT14I CCWWGG 2 cut(s) 437, 472
ErhI CCWWGG 2 cut(s) 437, 472
FauNDI CATATG 1 cut(s) 336
FblI GTMKAC 1 cut(s) 729
Fnu4HI GCNGC 3 cut(s) 5, 274, 326
FokI GGATG 1 cut(s) 756
Fsp4HI GCNGC 3 cut(s) 5, 274, 326
FspBI CTAG 4 cut(s) 26, 626, 714, 954
GluI GCNGC 3 cut(s) 5, 274, 326
GsuI CTGGAG 1 cut(s) 452
HaeIII GGCC 5 cut(s) 258, 429, 477, 482, 532
HapII CCGG 2 cut(s) 478, 483
HincII GTYRAC 3 cut(s) 122, 466, 697
HindII GTYRAC 3 cut(s) 122, 466, 697
HinfI GANTC 1 cut(s) 984
HpaI GTTAAC 1 cut(s) 697
HpaII CCGG 2 cut(s) 478, 483
HphI GGTGA 1 cut(s) 656
Hpy166II GTNNAC 5 cut(s) 122, 377, 466, 697, 730
Hpy188I TCNGA 3 cut(s) 496, 664, 939
Hpy188III TCNNGA 6 cut(s) 101, 206, 638, 743, 1009, 1100
Hpy8I GTNNAC 5 cut(s) 122, 377, 466, 697, 730
HpyAV CCTTC 2 cut(s) 566, 877
HpyCH4III ACNGT 1 cut(s) 136
HpyCH4V TGCA 8 cut(s) 4, 152, 268, 276, 325, 862, 932, 973
HpyF10VI GCNNNNNNNGC 1 cut(s) 529
HpyF3I CTNAG 6 cut(s) 44, 70, 290, 597, 799, 938
KspAI GTTAAC 1 cut(s) 697
Kzo9I GATC 5 cut(s) 156, 179, 331, 628, 1085
LmnI GCTCC 3 cut(s) 433, 563, 886
Lsp1109I GCAGC 3 cut(s) 16, 260, 337
MaeI CTAG 4 cut(s) 26, 626, 714, 954
MaeIII GTNAC 1 cut(s) 992
MalI GATC 5 cut(s) 158, 181, 333, 630, 1087
MboI GATC 5 cut(s) 156, 179, 331, 628, 1085
MboII GAAGA 7 cut(s) 235, 398, 427, 619, 622, 884, 887
MflI RGATCY 1 cut(s) 179
MhlI GDGCHC 1 cut(s) 79
MluCI AATT 9 cut(s) 83, 201, 506, 535, 673, 720, 914, 1028, 1041
MnlI CCTC 7 cut(s) 25, 479, 543, 606, 675, 868, 871
MseI TTAA 2 cut(s) 356, 696
MslI CAYNNNNRTG 1 cut(s) 642
MspA1I CMGCKG 1 cut(s) 59
MspI CCGG 2 cut(s) 478, 483
MspR9I CCNGG 2 cut(s) 431, 479
MvaI CCWGG 1 cut(s) 431
MvnI CGCG 1 cut(s) 172
MwoI GCNNNNNNNGC 1 cut(s) 529
NciI CCSGG 1 cut(s) 479
NdeI CATATG 1 cut(s) 336
NdeII GATC 5 cut(s) 156, 179, 331, 628, 1085
NlaIV GGNNCC 2 cut(s) 435, 554
NmuCI GTSAC 1 cut(s) 992
NspI RCATGY 4 cut(s) 166, 366, 570, 1019
NspV TTCGAA 1 cut(s) 982
PagI TCATGA 4 cut(s) 100, 637, 742, 1008
PciI ACATGT 1 cut(s) 162
PfeI GAWTC 1 cut(s) 984
PflMI CCANNNNNTGG 1 cut(s) 781
PkrI GCNGC 3 cut(s) 6, 275, 327
PpuMI RGGWCCY 1 cut(s) 552
PscI ACATGT 1 cut(s) 162
PsiI TTATAA 1 cut(s) 110
Psp5II RGGWCCY 1 cut(s) 552
Psp6I CCWGG 1 cut(s) 429
PspGI CCWGG 1 cut(s) 429
PspN4I GGNNCC 2 cut(s) 435, 554
PspPI GGNCC 3 cut(s) 480, 552, 957
PspPPI RGGWCCY 1 cut(s) 552
PstI CTGCAG 1 cut(s) 278
PsuI RGATCY 1 cut(s) 179
RsaI GTAC 3 cut(s) 148, 231, 253
RsaNI GTAC 3 cut(s) 147, 230, 252
RseI CAYNNNNRTG 1 cut(s) 642
SaqAI TTAA 2 cut(s) 356, 696
SatI GCNGC 3 cut(s) 5, 274, 326
Sau3AI GATC 5 cut(s) 156, 179, 331, 628, 1085
Sau96I GGNCC 3 cut(s) 480, 552, 957
ScaI AGTACT 1 cut(s) 253
ScrFI CCNGG 2 cut(s) 431, 479
SduI GDGCHC 1 cut(s) 79
SetI ASST 8 cut(s) 9, 36, 71, 319, 471, 617, 627, 709
SfcI CTRYAG 1 cut(s) 274
SfuI TTCGAA 1 cut(s) 982
SinI GGWCC 2 cut(s) 552, 957
SmiMI CAYNNNNRTG 1 cut(s) 642
SmlI CTYRAG 1 cut(s) 443
SmoI CTYRAG 1 cut(s) 443
Sse9I AATT 9 cut(s) 83, 201, 506, 535, 673, 720, 914, 1028, 1041
SsiI CCGC 1 cut(s) 57
SspI AATATT 2 cut(s) 810, 979
SspMI CTAG 4 cut(s) 26, 626, 714, 954
StyD4I CCNGG 2 cut(s) 429, 477
StyI CCWWGG 2 cut(s) 437, 472
TaaI ACNGT 1 cut(s) 136
TaqI TCGA 6 cut(s) 65, 159, 186, 851, 982, 1057
TasI AATT 9 cut(s) 83, 201, 506, 535, 673, 720, 914, 1028, 1041
TatI WGTACW 2 cut(s) 229, 251
TfiI GAWTC 1 cut(s) 984
Tru1I TTAA 2 cut(s) 356, 696
Tru9I TTAA 2 cut(s) 356, 696
TscAI CASTG 3 cut(s) 84, 98, 786
TseFI GTSAC 1 cut(s) 992
TseI GCWGC 3 cut(s) 4, 273, 325
Tsp45I GTSAC 1 cut(s) 992
TspDTI ATGAA 9 cut(s) 89, 225, 323, 428, 519, 731, 739, 997, 1025
TspRI CASTG 3 cut(s) 84, 98, 786
Van91I CCANNNNNTGG 1 cut(s) 781
VpaK11BI GGWCC 2 cut(s) 552, 957
XapI RAATTY 5 cut(s) 201, 506, 535, 673, 1028
XceI RCATGY 4 cut(s) 166, 366, 570, 1019
XmiI GTMKAC 1 cut(s) 729
XspI CTAG 4 cut(s) 26, 626, 714, 954
ZrmI AGTACT 1 cut(s) 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.