Rmu_sc0001694.1_g000011

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001694.1
OG0018667
Physical Location & Seq
Reverse (-)
82813 .. 84389
1577 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 489 bp
atgaatggttcctttgataactctactaatcatggtggaattggagtgatcattagagattcttcttgtgcttgtgttggtgggttctacagaacagttcgtaatgtctcctcaacagaacaaattgacgctttggccgggagggcggcaagctcacatgctttggagcatgaactctctccggtcatctttgagatggattctcaggtacttgttcaagcagtcaagcagagcgtcatcccccatacttcctctttgggtcatgtgatctcttggatccaattttgggaaaggtctagttggttggagtggcgcttatgttcatggaacgacgagaatggcataaggttgatggtgatggtccgacaaaagtggcgaagcgatgtggtgagtagtctatcgacaatggctctggtggggttgggccaagcttggctggcagcctgtggtcctcctgtctttagggctgaggctttggcttgggtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1

Protein Analysis

162

Amino Acids

17.86

Weight (kDa)

6.18

Isoelectric Point (pI)

44.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 98 1.4e-12 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018667)

Species Orthologous Gene IDs
rosa_laevigata RLG00000021160 RLG00000027272
rosa_multiflora Rmu_sc0001694.1_g000011 Rmu_sc0012684.1_g000003
rosa_rugosa Rorug01G0091500 Rorug06G0032100
rosa_samantha Rh5AG416100 Rh5DG340000 Rh7AG456400
rosa_wichuraiana Rw2G017880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 146
AclWI GGATC 2 cut(s) 271, 284
AcoI YGGCCR 1 cut(s) 135
AfaI GTAC 1 cut(s) 210
AfiI CCNNNNNNNGG 1 cut(s) 286
AgsI TTSAA 1 cut(s) 218
AluBI AGCT 2 cut(s) 153, 431
AluI AGCT 2 cut(s) 153, 431
Alw26I GTCTC 1 cut(s) 112
AlwI GGATC 2 cut(s) 271, 284
AoxI GGCC 2 cut(s) 135, 424
ApeKI GCWGC 1 cut(s) 440
AspLEI GCGC 1 cut(s) 315
AspS9I GGNCC 3 cut(s) 361, 424, 449
AsuC2I CCSGG 1 cut(s) 139
AsuHPI GGTGA 2 cut(s) 367, 400
AvaII GGWCC 2 cut(s) 361, 449
BamHI GGATCC 1 cut(s) 276
BbvCI CCTCAGC 1 cut(s) 468
BbvI GCAGC 1 cut(s) 452
BccI CCATC 3 cut(s) 190, 346, 352
BclI TGATCA 1 cut(s) 48
BcnI CCSGG 1 cut(s) 139
BcoDI GTCTC 1 cut(s) 112
BfaI CTAG 1 cut(s) 297
BfmI CTRYAG 1 cut(s) 88
BfoI RGCGCY 1 cut(s) 316
BglI GCCNNNNNGGC 1 cut(s) 143
BisI GCNGC 2 cut(s) 147, 441
BlsI GCNGC 2 cut(s) 148, 442
Bme1390I CCNGG 1 cut(s) 139
Bme18I GGWCC 2 cut(s) 361, 449
BmgT120I GGNCC 3 cut(s) 361, 424, 449
BmiI GGNNCC 2 cut(s) 10, 278
BmrFI CCNGG 1 cut(s) 139
Bpu10I CCTNAGC 1 cut(s) 468
BpuMI CCSGG 1 cut(s) 139
BsaWI WCCGGW 1 cut(s) 181
Bsc4I CCNNNNNNNGG 1 cut(s) 286
BseGI GGATG 1 cut(s) 237
BseLI CCNNNNNNNGG 1 cut(s) 286
BseMII CTCAG 2 cut(s) 218, 459
BseRI GAGGAG 1 cut(s) 100
BseXI GCAGC 1 cut(s) 452
BshFI GGCC 2 cut(s) 137, 426
BsiSI CCGG 2 cut(s) 138, 182
BslI CCNNNNNNNGG 1 cut(s) 286
BsmAI GTCTC 1 cut(s) 112
BsnI GGCC 2 cut(s) 137, 426
Bsp143I GATC 3 cut(s) 48, 267, 276
BspACI CCGC 1 cut(s) 146
BspANI GGCC 2 cut(s) 137, 426
BspCNI CTCAG 2 cut(s) 217, 460
BspLI GGNNCC 2 cut(s) 10, 278
BspPI GGATC 2 cut(s) 271, 284
BssMI GATC 3 cut(s) 48, 267, 276
Bst4CI ACNGT 1 cut(s) 97
BstC8I GCNNGC 2 cut(s) 151, 438
BstDEI CTNAG 2 cut(s) 204, 468
BstF5I GGATG 1 cut(s) 237
BstH2I RGCGCY 1 cut(s) 316
BstHHI GCGC 1 cut(s) 315
BstKTI GATC 3 cut(s) 51, 270, 279
BstMAI GTCTC 1 cut(s) 112
BstMBI GATC 3 cut(s) 48, 267, 276
BstMWI GCNNNNNNNGC 2 cut(s) 143, 437
BstNSI RCATGY 1 cut(s) 161
BstSCI CCNGG 1 cut(s) 137
BstSFI CTRYAG 1 cut(s) 88
BstV1I GCAGC 1 cut(s) 452
BstX2I RGATCY 1 cut(s) 276
BstYI RGATCY 1 cut(s) 276
BsuRI GGCC 2 cut(s) 137, 426
BtgZI GCGATG 1 cut(s) 396
BtsCI GGATG 1 cut(s) 237
Cac8I GCNNGC 2 cut(s) 151, 438
CfoI GCGC 1 cut(s) 315
Cfr13I GGNCC 3 cut(s) 361, 424, 449
CseI GACGC 2 cut(s) 137, 223
Csp6I GTAC 1 cut(s) 209
CviAII CATG 5 cut(s) 32, 158, 170, 263, 324
CviQI GTAC 1 cut(s) 209
DdeI CTNAG 2 cut(s) 204, 468
DpnI GATC 3 cut(s) 50, 269, 278
DpnII GATC 3 cut(s) 48, 267, 276
EaeI YGGCCR 1 cut(s) 135
Eco47I GGWCC 2 cut(s) 361, 449
FaeI CATG 5 cut(s) 35, 161, 173, 266, 327
FaiI YATR 8 cut(s) 33, 159, 171, 246, 264, 319, 325, 344
FatI CATG 5 cut(s) 31, 157, 169, 262, 323
FbaI TGATCA 1 cut(s) 48
Fnu4HI GCNGC 2 cut(s) 147, 441
FokI GGATG 1 cut(s) 224
Fsp4HI GCNGC 2 cut(s) 147, 441
FspBI CTAG 1 cut(s) 297
GlaI GCGC 1 cut(s) 314
GluI GCNGC 2 cut(s) 147, 441
HaeII RGCGCY 1 cut(s) 316
HaeIII GGCC 2 cut(s) 137, 426
HapII CCGG 2 cut(s) 138, 182
HgaI GACGC 2 cut(s) 137, 223
HhaI GCGC 1 cut(s) 315
Hin1II CATG 5 cut(s) 35, 161, 173, 266, 327
Hin6I GCGC 1 cut(s) 313
HinP1I GCGC 1 cut(s) 313
HindIII AAGCTT 1 cut(s) 429
HinfI GANTC 2 cut(s) 59, 200
HpaII CCGG 2 cut(s) 138, 182
HphI GGTGA 2 cut(s) 367, 400
Hpy188I TCNGA 2 cut(s) 365, 488
Hpy99I CGWCG 1 cut(s) 335
HpyCH4III ACNGT 1 cut(s) 97
HpyF10VI GCNNNNNNNGC 2 cut(s) 143, 437
HpyF3I CTNAG 2 cut(s) 204, 468
Hsp92II CATG 5 cut(s) 35, 161, 173, 266, 327
HspAI GCGC 1 cut(s) 313
Ksp22I TGATCA 1 cut(s) 48
Kzo9I GATC 3 cut(s) 48, 267, 276
LmnI GCTCC 1 cut(s) 166
LpnPI CCDG 7 cut(s) 151, 191, 195, 398, 422, 457, 468
Lsp1109I GCAGC 1 cut(s) 452
MaeI CTAG 1 cut(s) 297
MalI GATC 3 cut(s) 50, 269, 278
MboI GATC 3 cut(s) 48, 267, 276
MboII GAAGA 1 cut(s) 54
MflI RGATCY 1 cut(s) 276
MluCI AATT 3 cut(s) 39, 123, 281
MmeI TCCRAC 2 cut(s) 285, 388
MnlI CCTC 5 cut(s) 121, 135, 262, 462, 463
MspI CCGG 2 cut(s) 138, 182
MspR9I CCNGG 1 cut(s) 139
MwoI GCNNNNNNNGC 2 cut(s) 143, 437
NciI CCSGG 1 cut(s) 139
NdeII GATC 3 cut(s) 48, 267, 276
NlaIII CATG 5 cut(s) 35, 161, 173, 266, 327
NlaIV GGNNCC 2 cut(s) 10, 278
NspI RCATGY 1 cut(s) 161
PfeI GAWTC 2 cut(s) 59, 200
PkrI GCNGC 2 cut(s) 148, 442
PspN4I GGNNCC 2 cut(s) 10, 278
PspPI GGNCC 3 cut(s) 361, 424, 449
PsuI RGATCY 1 cut(s) 276
RsaI GTAC 1 cut(s) 210
RsaNI GTAC 1 cut(s) 209
SatI GCNGC 2 cut(s) 147, 441
Sau3AI GATC 3 cut(s) 48, 267, 276
Sau96I GGNCC 3 cut(s) 361, 424, 449
ScrFI CCNGG 1 cut(s) 139
SetI ASST 5 cut(s) 155, 210, 296, 350, 433
SfcI CTRYAG 1 cut(s) 88
SinI GGWCC 2 cut(s) 361, 449
Sse9I AATT 3 cut(s) 39, 123, 281
SsiI CCGC 1 cut(s) 146
SspMI CTAG 1 cut(s) 297
StyD4I CCNGG 1 cut(s) 137
TaaI ACNGT 1 cut(s) 97
TaqI TCGA 1 cut(s) 401
TasI AATT 3 cut(s) 39, 123, 281
TauI GCSGC 1 cut(s) 149
TfiI GAWTC 2 cut(s) 59, 200
TseI GCWGC 1 cut(s) 440
TspDTI ATGAA 3 cut(s) 17, 186, 312
VpaK11BI GGWCC 2 cut(s) 361, 449
XceI RCATGY 1 cut(s) 161
XspI CTAG 1 cut(s) 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.