Rmu_sc0001734.1_g000001

DnaJ central domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001734.1
OG0015685
Physical Location & Seq
Reverse (-)
6942 .. 10064
3123 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001734.1_g000001.1.cds

Sequence Viewer

Length: 1269 bp
atgtttcgccatgcctcgaggaacagtgataacaccaagtattatgaggtccttggtgtccccaaaactgcaagtcaagacgagctgaagaaggcatataagaaagctgctatcaagaatcatcctgacaaaggtggagatcctgaaaagttcaaggagttaggtcaagcttatgaagttcttaatgatccagaaaagagagaagtctatgaccaatatggtgaagatggtcttaaagacggaccaggacgtggtggtccctcacataatccatttgatatatttgaaacgtttttgaatccacgttatcgttcacatgtaagaaggcagaaacaaggtgaagatgtggtccataccttaaaggtttctttggaggacttgtacaatggcacaacaaagaaactctctctctctaggaatattttgtgtcccaaatgtaaagggaaaggctcaaagagcggagcaacagggagatgttacggatgccgtggtgctggaatgaaggttacaacacggtcaattggattgggcatgtttcaacagatgcaacatctctgccctgattgccgtggctctggtgaggtaatcagtgatagagataaatgcccaccatgcaaaggaaacaagatcagtcacgaaaagaaggtgctggatgtgcacatagagaagggaatggagcatggacagaaaattgtctttgagggacaggctgatgaagctcctgatacaattaccggggatattgttatcatagtgcaactcaaggagcacaccaagttcaagcggaagtttgatgatctttacatagaacacactctcagtttaactgaggctctgtgtgggtttcagtttgtgttggctcatcttgatggcaggccgcttctggtcaaatcaaatcctggagaagtcatgaagcctggtcaatccaaagcaatcaatgatgagggcatgccgcatcacaaaaggccattcataaagggcatgcttttcatccatttcaacgtagaatttccagattctgggattctttcccctgatcaatgccgaaatatagcgacaatactaacacccaagccaagcaagaagcatttgactgacatggagcttgatgagtgtgaggaaaccactatgcatgatgtcaatattgaggatgagatgaggcgcaagtcaaaacaacagtaccgggaggcatatgatgatgatgatgatgatgatgatgaagaaggtgatgatgaccccatgccacgggtgcagtgtgcccagcagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04141 map04141
Pfam Domains
Protein Families
DnaJ DnaJ_C DnaJ_CXXCXGXG

Protein Analysis

422

Amino Acids

47.7

Weight (kDa)

6.21

Isoelectric Point (pI)

37.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015685)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g09580
malus_domestica MD07G1100100.v1.1
prunus_persica Prupe.2G123700_v2.0.a1 Prupe.2G123700_v2.0.a1 Prupe.2G123700_v2.0.a1
pyrus_communis pycom07g08230
rosa_chinensis RchiOBHm_Chr1g0346511
rosa_laevigata RLG00000028797
rosa_multiflora Rmu_sc0001734.1_g000001
rosa_roxburghii Rroxscaffold_4G00308490
rosa_rugosa Rorug01G0180500 Rorug01G0180600
rosa_samantha Rh1BG166200 Rh1CG184500 Rh1DG197100
rosa_wichuraiana Rw1G016750

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 255
AbsI CCTCGAGG 1 cut(s) 16
AccB7I CCANNNNNTGG 2 cut(s) 251, 1019
AccBSI CCGCTC 1 cut(s) 459
AciI CCGC 4 cut(s) 459, 784, 878, 953
AclI AACGTT 1 cut(s) 290
AclWI GGATC 2 cut(s) 134, 182
AcsI RAATTY 1 cut(s) 1007
AcuI CTGAAG 1 cut(s) 107
AfaI GTAC 2 cut(s) 383, 1181
AfiI CCNNNNNNNGG 5 cut(s) 131, 251, 617, 1019, 1245
AflIII ACRYGT 1 cut(s) 316
AgsI TTSAA 6 cut(s) 154, 287, 298, 539, 781, 1000
AjiI CACGTC 1 cut(s) 251
AjnI CCWGG 3 cut(s) 244, 898, 916
AluBI AGCT 5 cut(s) 85, 107, 170, 719, 1105
AluI AGCT 5 cut(s) 85, 107, 170, 719, 1105
Alw21I GWGCWC 2 cut(s) 660, 771
Alw44I GTGCAC 1 cut(s) 656
AlwI GGATC 2 cut(s) 134, 182
AlwNI CAGNNNCTG 1 cut(s) 1019
Ama87I CYCGRG 1 cut(s) 16
AoxI GGCC 2 cut(s) 875, 965
ApaLI GTGCAC 1 cut(s) 656
ApeKI GCWGC 1 cut(s) 107
ApoI RAATTY 1 cut(s) 1007
AspLEI GCGC 1 cut(s) 1164
AspS9I GGNCC 4 cut(s) 49, 242, 257, 349
AsuC2I CCSGG 2 cut(s) 736, 1184
AsuHPI GGTGA 4 cut(s) 233, 350, 590, 1238
AvaI CYCGRG 1 cut(s) 16
AvaII GGWCC 4 cut(s) 49, 242, 257, 349
BaeGI GKGCMC 2 cut(s) 660, 1261
BaeI ACNNNNGTAYC 2 cut(s) 1163, 1196
Bbv12I GWGCWC 2 cut(s) 660, 771
BbvI GCAGC 1 cut(s) 94
BccI CCATC 2 cut(s) 221, 863
BceAI ACGGC 2 cut(s) 471, 552
BciT130I CCWGG 3 cut(s) 246, 900, 918
BclI TGATCA 1 cut(s) 1036
BcnI CCSGG 2 cut(s) 736, 1184
BfaI CTAG 1 cut(s) 414
BisI GCNGC 3 cut(s) 108, 878, 953
BlsI GCNGC 3 cut(s) 109, 879, 954
Bme1390I CCNGG 5 cut(s) 246, 736, 900, 918, 1184
Bme18I GGWCC 4 cut(s) 49, 242, 257, 349
BmeT110I CYCGRG 1 cut(s) 16
BmgBI CACGTC 1 cut(s) 251
BmgT120I GGNCC 4 cut(s) 49, 242, 257, 349
BmiI GGNNCC 1 cut(s) 259
BmrFI CCNGG 5 cut(s) 246, 736, 900, 918, 1184
BmsI GCATC 3 cut(s) 473, 534, 964
BpmI CTGGAG 1 cut(s) 921
BpuEI CTTGAG 1 cut(s) 746
BpuMI CCSGG 2 cut(s) 736, 1184
BsaJI CCNNGG 5 cut(s) 52, 487, 568, 735, 1244
BsaXI ACNNNNNCTCC 2 cut(s) 365, 395
Bsc4I CCNNNNNNNGG 5 cut(s) 131, 251, 617, 1019, 1245
BseBI CCWGG 3 cut(s) 246, 900, 918
BseDI CCNNGG 5 cut(s) 52, 487, 568, 735, 1244
BseGI GGATG 5 cut(s) 121, 488, 658, 990, 1156
BseLI CCNNNNNNNGG 5 cut(s) 131, 251, 617, 1019, 1245
BseMII CTCAG 2 cut(s) 819, 832
BseSI GKGCMC 2 cut(s) 660, 1261
BseXI GCAGC 1 cut(s) 94
BseYI CCCAGC 1 cut(s) 1260
BshFI GGCC 2 cut(s) 877, 967
BsiHKAI GWGCWC 2 cut(s) 660, 771
BsiHKCI CYCGRG 1 cut(s) 16
BsiSI CCGG 2 cut(s) 735, 1183
BslFI GGGAC 4 cut(s) 44, 243, 414, 717
BslI CCNNNNNNNGG 5 cut(s) 131, 251, 617, 1019, 1245
BsmFI GGGAC 4 cut(s) 44, 243, 414, 717
BsnI GGCC 2 cut(s) 877, 967
BsoBI CYCGRG 1 cut(s) 16
Bsp1286I GDGCHC 3 cut(s) 660, 771, 1261
Bsp1407I TGTACA 1 cut(s) 381
Bsp143I GATC 5 cut(s) 139, 187, 627, 796, 1036
BspACI CCGC 4 cut(s) 459, 784, 878, 953
BspANI GGCC 2 cut(s) 877, 967
BspCNI CTCAG 2 cut(s) 820, 831
BspHI TCATGA 1 cut(s) 909
BspLI GGNNCC 1 cut(s) 259
BspPI GGATC 2 cut(s) 134, 182
BsrBI CCGCTC 1 cut(s) 459
BsrGI TGTACA 1 cut(s) 381
BssECI CCNNGG 5 cut(s) 52, 487, 568, 735, 1244
BssMI GATC 5 cut(s) 139, 187, 627, 796, 1036
BssT1I CCWWGG 1 cut(s) 52
Bst2UI CCWGG 3 cut(s) 246, 900, 918
Bst4CI ACNGT 3 cut(s) 26, 516, 1179
BstAUI TGTACA 1 cut(s) 381
BstC8I GCNNGC 3 cut(s) 875, 950, 983
BstDEI CTNAG 2 cut(s) 818, 828
BstDSI CCRYGG 3 cut(s) 487, 568, 1244
BstENI CCTNNNNNAGG 1 cut(s) 129
BstF5I GGATG 5 cut(s) 121, 488, 658, 990, 1156
BstHHI GCGC 1 cut(s) 1164
BstKTI GATC 5 cut(s) 142, 190, 630, 799, 1039
BstMBI GATC 5 cut(s) 139, 187, 627, 796, 1036
BstMWI GCNNNNNNNGC 6 cut(s) 456, 564, 612, 655, 716, 1249
BstNI CCWGG 3 cut(s) 246, 900, 918
BstNSI RCATGY 4 cut(s) 320, 535, 952, 985
BstSCI CCNGG 5 cut(s) 244, 734, 898, 916, 1182
BstSLI GKGCMC 2 cut(s) 660, 1261
BstV1I GCAGC 1 cut(s) 94
BstX2I RGATCY 1 cut(s) 139
BstYI RGATCY 1 cut(s) 139
BsuRI GGCC 2 cut(s) 877, 967
BtgI CCRYGG 3 cut(s) 487, 568, 1244
BtrI CACGTC 1 cut(s) 251
BtsCI GGATG 5 cut(s) 121, 488, 658, 990, 1156
BtsI GCAGTG 1 cut(s) 1259
BtsIMutI CAGTG 3 cut(s) 31, 595, 1259
Cac8I GCNNGC 3 cut(s) 875, 950, 983
CaiI CAGNNNCTG 1 cut(s) 1019
CciI TCATGA 1 cut(s) 909
CfoI GCGC 1 cut(s) 1164
Cfr13I GGNCC 4 cut(s) 49, 242, 257, 349
Csp6I GTAC 2 cut(s) 382, 1180
CviQI GTAC 2 cut(s) 382, 1180
DdeI CTNAG 2 cut(s) 818, 828
DpnI GATC 5 cut(s) 141, 189, 629, 798, 1038
DpnII GATC 5 cut(s) 139, 187, 627, 796, 1036
DrdI GACNNNNNNGTC 1 cut(s) 255
DseDI GACNNNNNNGTC 1 cut(s) 255
Eco130I CCWWGG 1 cut(s) 52
Eco47I GGWCC 4 cut(s) 49, 242, 257, 349
Eco57I CTGAAG 1 cut(s) 107
Eco88I CYCGRG 1 cut(s) 16
EcoNI CCTNNNNNAGG 1 cut(s) 129
EcoO109I RGGNCCY 1 cut(s) 49
EcoRII CCWGG 3 cut(s) 244, 898, 916
EcoT14I CCWWGG 1 cut(s) 52
EcoT22I ATGCAT 1 cut(s) 1134
ErhI CCWWGG 1 cut(s) 52
FalI AAGNNNNNCTT 2 cut(s) 216, 248
FaqI GGGAC 4 cut(s) 44, 243, 414, 717
FauNDI CATATG 1 cut(s) 1192
FbaI TGATCA 1 cut(s) 1036
Fnu4HI GCNGC 3 cut(s) 108, 878, 953
FokI GGATG 5 cut(s) 108, 495, 665, 977, 1163
Fsp4HI GCNGC 3 cut(s) 108, 878, 953
FspBI CTAG 1 cut(s) 414
GlaI GCGC 1 cut(s) 1163
GluI GCNGC 3 cut(s) 108, 878, 953
GsaI CCCAGC 1 cut(s) 1264
GsuI CTGGAG 1 cut(s) 921
HaeIII GGCC 2 cut(s) 877, 967
HapII CCGG 2 cut(s) 735, 1183
HhaI GCGC 1 cut(s) 1164
Hin6I GCGC 1 cut(s) 1162
HinP1I GCGC 1 cut(s) 1162
HindIII AAGCTT 1 cut(s) 168
HinfI GANTC 4 cut(s) 118, 298, 1016, 1024
HpaII CCGG 2 cut(s) 735, 1183
HphI GGTGA 4 cut(s) 233, 350, 590, 1238
Hpy166II GTNNAC 2 cut(s) 314, 658
Hpy8I GTNNAC 2 cut(s) 314, 658
HpyAV CCTTC 6 cut(s) 85, 318, 496, 637, 661, 1217
HpyCH4III ACNGT 3 cut(s) 26, 516, 1179
HpyCH4IV ACGT 4 cut(s) 250, 290, 304, 1002
HpyCH4V TGCA 7 cut(s) 71, 547, 615, 658, 757, 1132, 1252
HpyF10VI GCNNNNNNNGC 6 cut(s) 456, 564, 612, 655, 716, 1249
HpyF3I CTNAG 2 cut(s) 818, 828
HpySE526I ACGT 4 cut(s) 250, 290, 304, 1002
HspAI GCGC 1 cut(s) 1162
Ksp22I TGATCA 1 cut(s) 1036
Kzo9I GATC 5 cut(s) 139, 187, 627, 796, 1036
LmnI GCTCC 5 cut(s) 461, 676, 724, 766, 1102
Lsp1109I GCAGC 1 cut(s) 94
LweI GCATC 3 cut(s) 473, 534, 964
MaeI CTAG 1 cut(s) 414
MaeII ACGT 4 cut(s) 250, 290, 304, 1002
MaeIII GTNAC 3 cut(s) 476, 505, 632
MalI GATC 5 cut(s) 141, 189, 629, 798, 1038
MbiI CCGCTC 1 cut(s) 459
MboI GATC 5 cut(s) 139, 187, 627, 796, 1036
MboII GAAGA 4 cut(s) 100, 236, 353, 1232
MfeI CAATTG 1 cut(s) 519
MflI RGATCY 1 cut(s) 139
MhlI GDGCHC 3 cut(s) 660, 771, 1261
MluCI AATT 4 cut(s) 519, 690, 729, 1007
Mph1103I ATGCAT 1 cut(s) 1134
MseI TTAA 4 cut(s) 183, 234, 359, 824
MslI CAYNNNNRTG 1 cut(s) 867
MspI CCGG 2 cut(s) 735, 1183
MspR9I CCNGG 5 cut(s) 246, 736, 900, 918, 1184
MunI CAATTG 1 cut(s) 519
MvaI CCWGG 3 cut(s) 246, 900, 918
MwoI GCNNNNNNNGC 6 cut(s) 456, 564, 612, 655, 716, 1249
NciI CCSGG 2 cut(s) 736, 1184
NdeI CATATG 1 cut(s) 1192
NdeII GATC 5 cut(s) 139, 187, 627, 796, 1036
NlaIV GGNNCC 1 cut(s) 259
NmuCI GTSAC 1 cut(s) 632
NsiI ATGCAT 1 cut(s) 1134
NspI RCATGY 4 cut(s) 320, 535, 952, 985
PaeI GCATGC 2 cut(s) 952, 985
PaeR7I CTCGAG 1 cut(s) 16
PagI TCATGA 1 cut(s) 909
PciI ACATGT 1 cut(s) 316
PfeI GAWTC 4 cut(s) 118, 298, 1016, 1024
PflMI CCANNNNNTGG 2 cut(s) 251, 1019
PfoI TCCNGGA 1 cut(s) 898
PkrI GCNGC 3 cut(s) 109, 879, 954
PpuMI RGGWCCY 1 cut(s) 49
PscI ACATGT 1 cut(s) 316
Psp1406I AACGTT 1 cut(s) 290
Psp5II RGGWCCY 1 cut(s) 49
Psp6I CCWGG 3 cut(s) 244, 898, 916
PspFI CCCAGC 1 cut(s) 1260
PspGI CCWGG 3 cut(s) 244, 898, 916
PspN4I GGNNCC 1 cut(s) 259
PspPI GGNCC 4 cut(s) 49, 242, 257, 349
PspPPI RGGWCCY 1 cut(s) 49
PspXI VCTCGAGB 1 cut(s) 16
PstNI CAGNNNCTG 1 cut(s) 1019
PsuI RGATCY 1 cut(s) 139
RsaI GTAC 2 cut(s) 383, 1181
RsaNI GTAC 2 cut(s) 382, 1180
RseI CAYNNNNRTG 1 cut(s) 867
SaqAI TTAA 4 cut(s) 183, 234, 359, 824
SatI GCNGC 3 cut(s) 108, 878, 953
Sau3AI GATC 5 cut(s) 139, 187, 627, 796, 1036
Sau96I GGNCC 4 cut(s) 49, 242, 257, 349
ScrFI CCNGG 5 cut(s) 246, 736, 900, 918, 1184
SduI GDGCHC 3 cut(s) 660, 771, 1261
SfaNI GCATC 3 cut(s) 473, 534, 964
Sfr274I CTCGAG 1 cut(s) 16
SinI GGWCC 4 cut(s) 49, 242, 257, 349
SlaI CTCGAG 1 cut(s) 16
SmiMI CAYNNNNRTG 1 cut(s) 867
SmlI CTYRAG 2 cut(s) 16, 761
SmoI CTYRAG 2 cut(s) 16, 761
SphI GCATGC 2 cut(s) 952, 985
Sse9I AATT 4 cut(s) 519, 690, 729, 1007
SsiI CCGC 4 cut(s) 459, 784, 878, 953
SspI AATATT 2 cut(s) 421, 1144
SspMI CTAG 1 cut(s) 414
StyD4I CCNGG 5 cut(s) 244, 734, 898, 916, 1182
StyI CCWWGG 1 cut(s) 52
TaaI ACNGT 3 cut(s) 26, 516, 1179
TaiI ACGT 4 cut(s) 253, 293, 307, 1005
TaqI TCGA 1 cut(s) 17
TasI AATT 4 cut(s) 519, 690, 729, 1007
TatI WGTACW 1 cut(s) 381
TauI GCSGC 2 cut(s) 880, 955
TfiI GAWTC 4 cut(s) 118, 298, 1016, 1024
Tru1I TTAA 4 cut(s) 183, 234, 359, 824
Tru9I TTAA 4 cut(s) 183, 234, 359, 824
TscAI CASTG 3 cut(s) 31, 595, 1259
TseFI GTSAC 1 cut(s) 632
TseI GCWGC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 632
TspDTI ATGAA 7 cut(s) 189, 515, 729, 926, 961, 979, 1233
TspGWI ACGGA 2 cut(s) 255, 495
TspRI CASTG 3 cut(s) 31, 595, 1259
Van91I CCANNNNNTGG 2 cut(s) 251, 1019
VneI GTGCAC 1 cut(s) 656
VpaK11BI GGWCC 4 cut(s) 49, 242, 257, 349
XagI CCTNNNNNAGG 1 cut(s) 129
XapI RAATTY 1 cut(s) 1007
XceI RCATGY 4 cut(s) 320, 535, 952, 985
XhoI CTCGAG 1 cut(s) 16
XspI CTAG 1 cut(s) 414
Zsp2I ATGCAT 1 cut(s) 1134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.