Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001753.1

Orthogroup ID

OG0014546

Physical Location & Seq

Genomic Coordinates Forward (+)

85480 .. 86100

Gene Structure 621 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001753.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 621 bp

atgcataaatcttattaccctgttgcatatctcaaaccattaggtgtatactcgcataaagaatccagcacagaatctgaaccaaacattggcaagatcagagatgcagctgctgccaggaaacaaccaaaaagaaacagcaaccgccgaacctctgcattgaatggtcacacaagtaacccaggtgatgatgactattggactccattgagcaatgctcttccagctgctgcctcaacctcccaaagcaactccaacatctcgagatcatcagaacctaattcacctgcagcaggtattggtggcaaaagatggaagcaaacaacacctgtaggtgataacattcgaagaaagagcaacccaattagatgggtggctccaatgggaccagcaatggttgcttcatttgttatagctagattacaaggagatgaagttgcaacagttaacggtagtactagtacaggcggtggtggtttgacagaacatgtatatggctctttagcactggacatagtcaacagctcttggttacagatcatcttggcagggatcacctggtatataattggaacaataattgtaggacttgcagatgccattcaaagtagggaaagttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DnaJ Fer4_13

Protein Analysis

206

Amino Acids

21.96

Weight (kDa)

9.65

Isoelectric Point (pI)

64.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014546)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G23240
fragaria_vesca	FvH4_4g37080
malus_domestica	MD13G1003800.v1.1
prunus_persica	Prupe.1G348700_v2.0.a1
pyrus_communis	pycom13g00320
rosa_chinensis	RchiOBHm_Chr4g0446831
rosa_laevigata	RLG00000005626
rosa_multiflora	Rmu_co8372733.1_g000001 Rmu_sc0001753.1_g000016 Rmu_sc0001753.1_g000019
rosa_roxburghii	Rroxscaffold_5G00387200
rosa_rugosa	Rorug04G0375000
rosa_samantha	Rh4AG436500 Rh4BG445600 Rh4CG462900 Rh4DG444300
rosa_wichuraiana	Rw4G037340

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	295
Acc36I	ACCTGC	2 cut(s)	284, 295
AccB7I	CCANNNNNTGG	1 cut(s)	89
AccI	GTMKAC	1 cut(s)	48
AciI	CCGC	2 cut(s)	145, 468
AclWI	GGATC	1 cut(s)	560
AfaI	GTAC	2 cut(s)	457, 463
AfiI	CCNNNNNNNGG	2 cut(s)	89, 293
AflIII	ACRYGT	1 cut(s)	487
AgsI	TTSAA	2 cut(s)	163, 605
AhlI	ACTAGT	1 cut(s)	458
AjnI	CCWGG	3 cut(s)	116, 181, 557
AjuI	GAANNNNNNNTTGG	2 cut(s)	72, 104
AluBI	AGCT	4 cut(s)	110, 227, 416, 525
AluI	AGCT	4 cut(s)	110, 227, 416, 525
AlwI	GGATC	1 cut(s)	560
AlwNI	CAGNNNCTG	3 cut(s)	77, 113, 230
Ama87I	CYCGRG	1 cut(s)	262
ApeKI	GCWGC	6 cut(s)	107, 110, 113, 227, 230, 290
AspS9I	GGNCC	1 cut(s)	386
AsuHPI	GGTGA	4 cut(s)	197, 276, 347, 547
AsuII	TTCGAA	1 cut(s)	346
AvaI	CYCGRG	1 cut(s)	262
AvaII	GGWCC	1 cut(s)	386
BbvI	GCAGC	6 cut(s)	97, 100, 119, 214, 217, 302
BccI	CCATC	2 cut(s)	306, 363
BciT130I	CCWGG	3 cut(s)	118, 183, 559
BcuI	ACTAGT	1 cut(s)	458
BfaI	CTAG	2 cut(s)	417, 459
BfmI	CTRYAG	2 cut(s)	288, 330
BfuAI	ACCTGC	2 cut(s)	284, 295
BisI	GCNGC	6 cut(s)	108, 111, 114, 228, 231, 291
BlsI	GCNGC	6 cut(s)	109, 112, 115, 229, 232, 292
BmcAI	AGTACT	1 cut(s)	457
Bme1390I	CCNGG	3 cut(s)	118, 183, 559
Bme18I	GGWCC	1 cut(s)	386
BmeT110I	CYCGRG	1 cut(s)	262
BmgT120I	GGNCC	1 cut(s)	386
BmiI	GGNNCC	2 cut(s)	378, 387
BmrFI	CCNGG	3 cut(s)	118, 183, 559
BmsI	GCATC	2 cut(s)	94, 586
BplI	GAGNNNNNCTC	2 cut(s)	202, 234
Bpu14I	TTCGAA	1 cut(s)	346
BsaJI	CCNNGG	1 cut(s)	181
BsaXI	ACNNNNNCTCC	2 cut(s)	420, 450
Bsc4I	CCNNNNNNNGG	2 cut(s)	89, 293
Bse1I	ACTGG	1 cut(s)	513
Bse3DI	GCAATG	2 cut(s)	220, 399
BseBI	CCWGG	3 cut(s)	118, 183, 559
BseDI	CCNNGG	1 cut(s)	181
BseLI	CCNNNNNNNGG	2 cut(s)	89, 293
BseMI	GCAATG	2 cut(s)	220, 399
BseNI	ACTGG	1 cut(s)	513
BseXI	GCAGC	6 cut(s)	97, 100, 119, 214, 217, 302
BsiHKCI	CYCGRG	1 cut(s)	262
BslFI	GGGAC	1 cut(s)	399
BslI	CCNNNNNNNGG	2 cut(s)	89, 293
BsmFI	GGGAC	1 cut(s)	399
BsoBI	CYCGRG	1 cut(s)	262
Bsp119I	TTCGAA	1 cut(s)	346
Bsp143I	GATC	4 cut(s)	96, 266, 537, 552
BspACI	CCGC	2 cut(s)	145, 468
BspLI	GGNNCC	2 cut(s)	378, 387
BspMAI	CTGCAG	1 cut(s)	292
BspMI	ACCTGC	2 cut(s)	284, 295
BspPI	GGATC	1 cut(s)	560
BspQI	GCTCTTC	1 cut(s)	225
BspT104I	TTCGAA	1 cut(s)	346
BsrDI	GCAATG	2 cut(s)	220, 399
BsrI	ACTGG	1 cut(s)	513
BssECI	CCNNGG	1 cut(s)	181
BssMI	GATC	4 cut(s)	96, 266, 537, 552
BssNAI	GTATAC	1 cut(s)	49
Bst1107I	GTATAC	1 cut(s)	49
Bst2UI	CCWGG	3 cut(s)	118, 183, 559
Bst4CI	ACNGT	2 cut(s)	445, 452
Bst6I	CTCTTC	1 cut(s)	225
BstAPI	GCANNNNNTGC	2 cut(s)	113, 398
BstBI	TTCGAA	1 cut(s)	346
BstENI	CCTNNNNNAGG	1 cut(s)	291
BstKTI	GATC	4 cut(s)	99, 269, 540, 555
BstMBI	GATC	4 cut(s)	96, 266, 537, 552
BstMWI	GCNNNNNNNGC	3 cut(s)	113, 224, 398
BstNI	CCWGG	3 cut(s)	118, 183, 559
BstNSI	RCATGY	1 cut(s)	491
BstSCI	CCNGG	3 cut(s)	116, 181, 557
BstSFI	CTRYAG	2 cut(s)	288, 330
BstV1I	GCAGC	6 cut(s)	97, 100, 119, 214, 217, 302
BstXI	CCANNNNNNTGG	1 cut(s)	369
BstZ17I	GTATAC	1 cut(s)	49
BtsIMutI	CAGTG	1 cut(s)	506
BveI	ACCTGC	2 cut(s)	284, 295
CaiI	CAGNNNCTG	3 cut(s)	77, 113, 230
Cfr13I	GGNCC	1 cut(s)	386
CsiI	ACCWGGT	1 cut(s)	557
Csp6I	GTAC	2 cut(s)	456, 462
CviAII	CATG	1 cut(s)	488
CviJI	RGCY	6 cut(s)	110, 227, 377, 416, 498, 525
CviKI_1	RGCY	6 cut(s)	110, 227, 377, 416, 498, 525
CviQI	GTAC	2 cut(s)	456, 462
DpnI	GATC	4 cut(s)	98, 268, 539, 554
DpnII	GATC	4 cut(s)	96, 266, 537, 552
Eam1104I	CTCTTC	1 cut(s)	225
EarI	CTCTTC	1 cut(s)	225
Eco47I	GGWCC	1 cut(s)	386
Eco88I	CYCGRG	1 cut(s)	262
EcoNI	CCTNNNNNAGG	1 cut(s)	291
EcoRII	CCWGG	3 cut(s)	116, 181, 557
EcoT22I	ATGCAT	1 cut(s)	6
FaeI	CATG	1 cut(s)	491
FaqI	GGGAC	1 cut(s)	399
FatI	CATG	1 cut(s)	487
FblI	GTMKAC	1 cut(s)	48
Fnu4HI	GCNGC	6 cut(s)	108, 111, 114, 228, 231, 291
Fsp4HI	GCNGC	6 cut(s)	108, 111, 114, 228, 231, 291
FspBI	CTAG	2 cut(s)	417, 459
GluI	GCNGC	6 cut(s)	108, 111, 114, 228, 231, 291
Hin1II	CATG	1 cut(s)	491
HincII	GTYRAC	2 cut(s)	448, 520
HindII	GTYRAC	2 cut(s)	448, 520
HinfI	GANTC	3 cut(s)	62, 74, 202
HpaI	GTTAAC	1 cut(s)	448
HphI	GGTGA	4 cut(s)	197, 276, 347, 547
Hpy166II	GTNNAC	3 cut(s)	49, 448, 520
Hpy188I	TCNGA	3 cut(s)	79, 101, 274
Hpy188III	TCNNGA	2 cut(s)	262, 264
Hpy8I	GTNNAC	3 cut(s)	49, 448, 520
HpyCH4III	ACNGT	2 cut(s)	445, 452
HpyCH4V	TGCA	7 cut(s)	4, 26, 107, 158, 290, 440, 593
HpyF10VI	GCNNNNNNNGC	3 cut(s)	113, 224, 398
Hsp92II	CATG	1 cut(s)	491
KspAI	GTTAAC	1 cut(s)	448
Kzo9I	GATC	4 cut(s)	96, 266, 537, 552
LguI	GCTCTTC	1 cut(s)	225
LmnI	GCTCC	1 cut(s)	382
Lsp1109I	GCAGC	6 cut(s)	97, 100, 119, 214, 217, 302
LweI	GCATC	2 cut(s)	94, 586
MabI	ACCWGGT	1 cut(s)	557
MaeI	CTAG	2 cut(s)	417, 459
MaeIII	GTNAC	3 cut(s)	167, 176, 531
MalI	GATC	4 cut(s)	98, 268, 539, 554
MboI	GATC	4 cut(s)	96, 266, 537, 552
MboII	GAAGA	2 cut(s)	212, 360
MluCI	AATT	4 cut(s)	280, 363, 567, 579
MlyI	GAGTC	1 cut(s)	196
MmeI	TCCRAC	1 cut(s)	279
MnlI	CCTC	3 cut(s)	163, 244, 250
Mph1103I	ATGCAT	1 cut(s)	6
MseI	TTAA	1 cut(s)	447
MslI	CAYNNNNRTG	1 cut(s)	492
MspA1I	CMGCKG	2 cut(s)	110, 227
MspR9I	CCNGG	3 cut(s)	118, 183, 559
MvaI	CCWGG	3 cut(s)	118, 183, 559
MwoI	GCNNNNNNNGC	3 cut(s)	113, 224, 398
NdeII	GATC	4 cut(s)	96, 266, 537, 552
NlaIII	CATG	1 cut(s)	491
NlaIV	GGNNCC	2 cut(s)	378, 387
NmuCI	GTSAC	1 cut(s)	167
NsiI	ATGCAT	1 cut(s)	6
NspI	RCATGY	1 cut(s)	491
NspV	TTCGAA	1 cut(s)	346
PaeR7I	CTCGAG	1 cut(s)	262
PaqCI	CACCTGC	1 cut(s)	295
PciI	ACATGT	1 cut(s)	487
PciSI	GCTCTTC	1 cut(s)	225
PfeI	GAWTC	2 cut(s)	62, 74
PflFI	GACNNNGTC	1 cut(s)	515
PflMI	CCANNNNNTGG	1 cut(s)	89
PkrI	GCNGC	6 cut(s)	109, 112, 115, 229, 232, 292
PleI	GAGTC	1 cut(s)	196
PpsI	GAGTC	1 cut(s)	196
PscI	ACATGT	1 cut(s)	487
Psp6I	CCWGG	3 cut(s)	116, 181, 557
PspGI	CCWGG	3 cut(s)	116, 181, 557
PspN4I	GGNNCC	2 cut(s)	378, 387
PspPI	GGNCC	1 cut(s)	386
PstI	CTGCAG	1 cut(s)	292
PstNI	CAGNNNCTG	3 cut(s)	77, 113, 230
PsyI	GACNNNGTC	1 cut(s)	515
PvuII	CAGCTG	2 cut(s)	110, 227
RsaI	GTAC	2 cut(s)	457, 463
RsaNI	GTAC	2 cut(s)	456, 462
RseI	CAYNNNNRTG	1 cut(s)	492
SapI	GCTCTTC	1 cut(s)	225
SaqAI	TTAA	1 cut(s)	447
SatI	GCNGC	6 cut(s)	108, 111, 114, 228, 231, 291
Sau3AI	GATC	4 cut(s)	96, 266, 537, 552
Sau96I	GGNCC	1 cut(s)	386
ScaI	AGTACT	1 cut(s)	457
SchI	GAGTC	1 cut(s)	196
ScrFI	CCNGG	3 cut(s)	118, 183, 559
SexAI	ACCWGGT	1 cut(s)	557
SfaNI	GCATC	2 cut(s)	94, 586
SfcI	CTRYAG	2 cut(s)	288, 330
Sfr274I	CTCGAG	1 cut(s)	262
SfuI	TTCGAA	1 cut(s)	346
SinI	GGWCC	1 cut(s)	386
SlaI	CTCGAG	1 cut(s)	262
SmiMI	CAYNNNNRTG	1 cut(s)	492
SmlI	CTYRAG	1 cut(s)	262
SmoI	CTYRAG	1 cut(s)	262
SpeI	ACTAGT	1 cut(s)	458
Sse9I	AATT	4 cut(s)	280, 363, 567, 579
SsiI	CCGC	2 cut(s)	145, 468
SspMI	CTAG	2 cut(s)	417, 459
StyD4I	CCNGG	3 cut(s)	116, 181, 557
TaaI	ACNGT	2 cut(s)	445, 452
TaqI	TCGA	2 cut(s)	263, 346
TasI	AATT	4 cut(s)	280, 363, 567, 579
TatI	WGTACW	2 cut(s)	455, 461
TfiI	GAWTC	2 cut(s)	62, 74
Tru1I	TTAA	1 cut(s)	447
Tru9I	TTAA	1 cut(s)	447
TscAI	CASTG	1 cut(s)	513
TseFI	GTSAC	1 cut(s)	167
TseI	GCWGC	6 cut(s)	107, 110, 113, 227, 230, 290
Tsp45I	GTSAC	1 cut(s)	167
TspDTI	ATGAA	2 cut(s)	393, 447
TspRI	CASTG	1 cut(s)	513
Tth111I	GACNNNGTC	1 cut(s)	515
Van91I	CCANNNNNTGG	1 cut(s)	89
VpaK11BI	GGWCC	1 cut(s)	386
XagI	CCTNNNNNAGG	1 cut(s)	291
XceI	RCATGY	1 cut(s)	491
XhoI	CTCGAG	1 cut(s)	262
XmiI	GTMKAC	1 cut(s)	48
XspI	CTAG	2 cut(s)	417, 459
ZrmI	AGTACT	1 cut(s)	457
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.