Rmu_sc0001793.1_g000034

Pectate lyase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001793.1
OG0009024
Physical Location & Seq
Reverse (-)
146853 .. 147332
480 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001793.1_g000034.1.cds

Sequence Viewer

Length: 270 bp
atgtctggtagaaatattgttgttaaattggcagtggacagggaggcggcaacgactggcttcattaggtcggaaggggacttattcataactggaactcaagcaggattagccaccgagggtggtgaaaattgcatgtttcatcctagccaacactaccagacatggacagtaggacctccagtggatgatctgaaacatgttctccaacattgcaccggatggcagtccattccccggccagctgatcaggcaagtgtagcacagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00040 ko02024 map00040 map02024
Pfam Domains
Protein Families
Pec_lyase_C

Protein Analysis

89

Amino Acids

9.63

Weight (kDa)

5.67

Isoelectric Point (pI)

47.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 47
AcoI YGGCCR 1 cut(s) 239
AfiI CCNNNNNNNGG 1 cut(s) 237
AflIII ACRYGT 1 cut(s) 199
AluBI AGCT 1 cut(s) 245
AluI AGCT 1 cut(s) 245
AoxI GGCC 1 cut(s) 239
AspS9I GGNCC 1 cut(s) 176
AsuC2I CCSGG 1 cut(s) 238
AsuHPI GGTGA 1 cut(s) 137
AvaII GGWCC 1 cut(s) 176
BccI CCATC 1 cut(s) 216
BclI TGATCA 1 cut(s) 247
BcnI CCSGG 1 cut(s) 238
BfaI CTAG 1 cut(s) 147
BisI GCNGC 1 cut(s) 48
BlsI GCNGC 1 cut(s) 49
Bme1390I CCNGG 1 cut(s) 238
Bme18I GGWCC 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 176
BmrFI CCNGG 1 cut(s) 238
BpmI CTGGAG 1 cut(s) 165
BpuEI CTTGAG 1 cut(s) 84
BpuMI CCSGG 1 cut(s) 238
BsaJI CCNNGG 2 cut(s) 117, 236
BsaWI WCCGGW 1 cut(s) 218
BsaXI ACNNNNNCTCC 2 cut(s) 189, 219
Bsc4I CCNNNNNNNGG 1 cut(s) 237
Bse1I ACTGG 3 cut(s) 61, 97, 182
Bse3DI GCAATG 1 cut(s) 211
BseDI CCNNGG 2 cut(s) 117, 236
BseGI GGATG 3 cut(s) 142, 193, 227
BseLI CCNNNNNNNGG 1 cut(s) 237
BseMI GCAATG 1 cut(s) 211
BseNI ACTGG 3 cut(s) 61, 97, 182
BshFI GGCC 1 cut(s) 241
BsiSI CCGG 2 cut(s) 219, 238
BslFI GGGAC 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 237
BsmFI GGGAC 1 cut(s) 92
BsnI GGCC 1 cut(s) 241
Bsp143I GATC 2 cut(s) 190, 247
BspACI CCGC 1 cut(s) 47
BspANI GGCC 1 cut(s) 241
BsrDI GCAATG 1 cut(s) 211
BsrI ACTGG 3 cut(s) 61, 97, 182
BssECI CCNNGG 2 cut(s) 117, 236
BssMI GATC 2 cut(s) 190, 247
Bst4CI ACNGT 2 cut(s) 172, 267
BstC8I GCNNGC 1 cut(s) 243
BstF5I GGATG 3 cut(s) 142, 193, 227
BstKTI GATC 2 cut(s) 193, 250
BstMBI GATC 2 cut(s) 190, 247
BstMWI GCNNNNNNNGC 3 cut(s) 110, 251, 260
BstNSI RCATGY 2 cut(s) 139, 203
BstSCI CCNGG 1 cut(s) 236
BsuRI GGCC 1 cut(s) 241
BtsCI GGATG 3 cut(s) 142, 193, 227
BtsI GCAGTG 1 cut(s) 39
BtsIMutI CAGTG 2 cut(s) 39, 189
Cac8I GCNNGC 1 cut(s) 243
Cfr13I GGNCC 1 cut(s) 176
CviAII CATG 3 cut(s) 136, 165, 200
CviJI RGCY 5 cut(s) 60, 113, 150, 241, 245
CviKI_1 RGCY 5 cut(s) 60, 113, 150, 241, 245
DpnI GATC 2 cut(s) 192, 249
DpnII GATC 2 cut(s) 190, 247
EaeI YGGCCR 1 cut(s) 239
Eco47I GGWCC 1 cut(s) 176
EcoO109I RGGNCCY 1 cut(s) 176
FaeI CATG 3 cut(s) 139, 168, 203
FaiI YATR 4 cut(s) 89, 137, 166, 201
FaqI GGGAC 1 cut(s) 92
FatI CATG 3 cut(s) 135, 164, 199
FbaI TGATCA 1 cut(s) 247
Fnu4HI GCNGC 1 cut(s) 48
FokI GGATG 3 cut(s) 129, 200, 234
Fsp4HI GCNGC 1 cut(s) 48
FspBI CTAG 1 cut(s) 147
GluI GCNGC 1 cut(s) 48
GsuI CTGGAG 1 cut(s) 165
HaeIII GGCC 1 cut(s) 241
HapII CCGG 2 cut(s) 219, 238
Hin1II CATG 3 cut(s) 139, 168, 203
HpaII CCGG 2 cut(s) 219, 238
HphI GGTGA 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 2 cut(s) 73, 195
Hpy8I GTNNAC 1 cut(s) 37
HpyAV CCTTC 1 cut(s) 68
HpyCH4III ACNGT 2 cut(s) 172, 267
HpyCH4V TGCA 2 cut(s) 135, 216
HpyF10VI GCNNNNNNNGC 3 cut(s) 110, 251, 260
Hsp92II CATG 3 cut(s) 139, 168, 203
Ksp22I TGATCA 1 cut(s) 247
Kzo9I GATC 2 cut(s) 190, 247
MaeI CTAG 1 cut(s) 147
MalI GATC 2 cut(s) 192, 249
MboI GATC 2 cut(s) 190, 247
MluCI AATT 2 cut(s) 26, 130
MmeI TCCRAC 2 cut(s) 51, 232
MnlI CCTC 3 cut(s) 37, 112, 189
MseI TTAA 1 cut(s) 24
MspA1I CMGCKG 1 cut(s) 245
MspI CCGG 2 cut(s) 219, 238
MspR9I CCNGG 1 cut(s) 238
MwoI GCNNNNNNNGC 3 cut(s) 110, 251, 260
NciI CCSGG 1 cut(s) 238
NdeII GATC 2 cut(s) 190, 247
NlaIII CATG 3 cut(s) 139, 168, 203
NspI RCATGY 2 cut(s) 139, 203
PciI ACATGT 1 cut(s) 199
PkrI GCNGC 1 cut(s) 49
PpuMI RGGWCCY 1 cut(s) 176
PscI ACATGT 1 cut(s) 199
Psp5II RGGWCCY 1 cut(s) 176
PspPI GGNCC 1 cut(s) 176
PspPPI RGGWCCY 1 cut(s) 176
PvuII CAGCTG 1 cut(s) 245
SaqAI TTAA 1 cut(s) 24
SatI GCNGC 1 cut(s) 48
Sau3AI GATC 2 cut(s) 190, 247
Sau96I GGNCC 1 cut(s) 176
ScrFI CCNGG 1 cut(s) 238
SetI ASST 3 cut(s) 71, 181, 247
SinI GGWCC 1 cut(s) 176
SmlI CTYRAG 1 cut(s) 99
SmoI CTYRAG 1 cut(s) 99
Sse9I AATT 2 cut(s) 26, 130
SsiI CCGC 1 cut(s) 47
SspI AATATT 1 cut(s) 16
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 236
TaaI ACNGT 2 cut(s) 172, 267
TasI AATT 2 cut(s) 26, 130
TauI GCSGC 1 cut(s) 50
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TscAI CASTG 2 cut(s) 39, 189
TspDTI ATGAA 3 cut(s) 52, 76, 131
TspRI CASTG 2 cut(s) 39, 189
VpaK11BI GGWCC 1 cut(s) 176
XceI RCATGY 2 cut(s) 139, 203
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.