Rmu_sc0001839.1_g000014

poly ADP-ribose polymerase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001839.1
OG0018229
Physical Location & Seq
Forward (+)
65438 .. 66484
1047 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 654 bp
atgcatccccattcccagatccggattgacaccgatgattatcaccaggaggaggaggttcctatgatcgtcgaggatcaagattcctggttggatcgccccgaatccaattcctccgatacgggttccgattccgattccgactcttgtaagcagattgatgaagattcggagtgtgattgggagagcgaaactgctgaatcgaattctattgatgattttggggtttttacaggaaatgggatgatgttcagagtgaatgatgtgagtgaggagtacgatagtattgtcaagagctttgctgtgggtatgagatcgacgggcggagctacgaaggttgtggaggtgcacaagaaatcgatttctggactgatcgggctggccagcttgaaaaatgaaggagaagaacgacaccggcggcggcgggtatgtgagggtggaccagatagatctgaagagcttggacgagcagcttcagaagcatctgagcaggacatggactatggagaagaacaagaacagagaccagcaggaacaacaaatccgaatattagatatgcttggtacaacagatcaagggatgagattgtggagataatggatcatggatttaatagtcataccatgaaattcaaagaaatctatttattataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PARP RST

Protein Analysis

217

Amino Acids

24.63

Weight (kDa)

4.48

Isoelectric Point (pI)

67.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 652
AccIII TCCGGA 1 cut(s) 21
AciI CCGC 4 cut(s) 324, 418, 421, 424
AclWI GGATC 4 cut(s) 13, 84, 102, 609
AcoI YGGCCR 1 cut(s) 381
AcsI RAATTY 2 cut(s) 205, 629
AcuI CTGAAG 2 cut(s) 459, 474
AfaI GTAC 2 cut(s) 278, 566
AfiI CCNNNNNNNGG 2 cut(s) 21, 52
AgsI TTSAA 2 cut(s) 391, 634
AjnI CCWGG 2 cut(s) 45, 86
AloI GAACNNNNNNTCC 2 cut(s) 526, 558
AluBI AGCT 5 cut(s) 297, 329, 387, 460, 473
AluI AGCT 5 cut(s) 297, 329, 387, 460, 473
Alw21I GWGCWC 1 cut(s) 351
Alw26I GTCTC 1 cut(s) 517
Alw44I GTGCAC 1 cut(s) 347
AlwI GGATC 4 cut(s) 13, 84, 102, 609
Aor13HI TCCGGA 1 cut(s) 21
AoxI GGCC 1 cut(s) 381
ApaLI GTGCAC 1 cut(s) 347
ApeKI GCWGC 1 cut(s) 470
ApoI RAATTY 2 cut(s) 205, 629
AspS9I GGNCC 1 cut(s) 440
AsuHPI GGTGA 1 cut(s) 35
AvaII GGWCC 1 cut(s) 440
BaeGI GKGCMC 1 cut(s) 351
BalI TGGCCA 1 cut(s) 383
Bbv12I GWGCWC 1 cut(s) 351
BbvI GCAGC 1 cut(s) 482
BciT130I CCWGG 2 cut(s) 47, 88
BcoDI GTCTC 1 cut(s) 517
BglII AGATCT 1 cut(s) 449
BisI GCNGC 3 cut(s) 419, 422, 471
BlsI GCNGC 3 cut(s) 420, 423, 472
Bme1390I CCNGG 2 cut(s) 47, 88
Bme18I GGWCC 1 cut(s) 440
BmgT120I GGNCC 1 cut(s) 440
BmiI GGNNCC 2 cut(s) 60, 127
BmrFI CCNGG 2 cut(s) 47, 88
BmsI GCATC 2 cut(s) 13, 491
Bsa29I ATCGAT 1 cut(s) 359
BsaBI GATNNNNATC 1 cut(s) 39
BsaI GGTCTC 1 cut(s) 517
BsaWI WCCGGW 1 cut(s) 21
Bsc4I CCNNNNNNNGG 2 cut(s) 21, 52
Bse118I RCCGGY 1 cut(s) 414
Bse8I GATNNNNATC 1 cut(s) 39
BseAI TCCGGA 1 cut(s) 21
BseBI CCWGG 2 cut(s) 47, 88
BseCI ATCGAT 1 cut(s) 359
BseGI GGATG 3 cut(s) 4, 249, 586
BseJI GATNNNNATC 1 cut(s) 39
BseLI CCNNNNNNNGG 2 cut(s) 21, 52
BseMII CTCAG 1 cut(s) 477
BseRI GAGGAG 3 cut(s) 65, 68, 287
BseSI GKGCMC 1 cut(s) 351
BseXI GCAGC 1 cut(s) 482
BshFI GGCC 1 cut(s) 383
BshVI ATCGAT 1 cut(s) 359
BsiHKAI GWGCWC 1 cut(s) 351
BsiSI CCGG 2 cut(s) 22, 415
BslI CCNNNNNNNGG 2 cut(s) 21, 52
BsmAI GTCTC 1 cut(s) 517
BsnI GGCC 1 cut(s) 383
Bso31I GGTCTC 1 cut(s) 517
Bsp1286I GDGCHC 1 cut(s) 351
Bsp13I TCCGGA 1 cut(s) 21
Bsp143I GATC 9 cut(s) 18, 66, 76, 94, 314, 372, 449, 572, 601
BspACI CCGC 4 cut(s) 324, 418, 421, 424
BspANI GGCC 1 cut(s) 383
BspCNI CTCAG 1 cut(s) 478
BspDI ATCGAT 1 cut(s) 359
BspEI TCCGGA 1 cut(s) 21
BspLI GGNNCC 2 cut(s) 60, 127
BspPI GGATC 4 cut(s) 13, 84, 102, 609
BspQI GCTCTTC 1 cut(s) 450
BspTNI GGTCTC 1 cut(s) 517
BsrFI RCCGGY 1 cut(s) 414
BssAI RCCGGY 1 cut(s) 414
BssMI GATC 9 cut(s) 18, 66, 76, 94, 314, 372, 449, 572, 601
Bst2UI CCWGG 2 cut(s) 47, 88
Bst6I CTCTTC 1 cut(s) 450
BstC8I GCNNGC 2 cut(s) 381, 385
BstDEI CTNAG 1 cut(s) 486
BstF5I GGATG 3 cut(s) 4, 249, 586
BstKTI GATC 9 cut(s) 21, 69, 79, 97, 317, 375, 452, 575, 604
BstMAI GTCTC 1 cut(s) 517
BstMBI GATC 9 cut(s) 18, 66, 76, 94, 314, 372, 449, 572, 601
BstMWI GCNNNNNNNGC 1 cut(s) 479
BstNI CCWGG 2 cut(s) 47, 88
BstSCI CCNGG 2 cut(s) 45, 86
BstSLI GKGCMC 1 cut(s) 351
BstV1I GCAGC 1 cut(s) 482
BstX2I RGATCY 2 cut(s) 18, 449
BstYI RGATCY 2 cut(s) 18, 449
Bsu15I ATCGAT 1 cut(s) 359
BsuRI GGCC 1 cut(s) 383
BsuTUI ATCGAT 1 cut(s) 359
BtsCI GGATG 3 cut(s) 4, 249, 586
Cac8I GCNNGC 2 cut(s) 381, 385
Cfr10I RCCGGY 1 cut(s) 414
Cfr13I GGNCC 1 cut(s) 440
ClaI ATCGAT 1 cut(s) 359
Csp6I GTAC 2 cut(s) 277, 565
CviAII CATG 3 cut(s) 496, 605, 625
CviJI RGCY 7 cut(s) 297, 329, 379, 383, 387, 460, 473
CviKI_1 RGCY 7 cut(s) 297, 329, 379, 383, 387, 460, 473
CviQI GTAC 2 cut(s) 277, 565
DdeI CTNAG 1 cut(s) 486
DpnI GATC 9 cut(s) 20, 68, 78, 96, 316, 374, 451, 574, 603
DpnII GATC 9 cut(s) 18, 66, 76, 94, 314, 372, 449, 572, 601
EaeI YGGCCR 1 cut(s) 381
Eam1104I CTCTTC 1 cut(s) 450
EarI CTCTTC 1 cut(s) 450
EciI GGCGGA 1 cut(s) 339
Eco31I GGTCTC 1 cut(s) 517
Eco47I GGWCC 1 cut(s) 440
Eco57I CTGAAG 2 cut(s) 459, 474
EcoRI GAATTC 1 cut(s) 205
EcoRII CCWGG 2 cut(s) 45, 86
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 3 cut(s) 499, 608, 628
FatI CATG 3 cut(s) 495, 604, 624
FauI CCCGC 1 cut(s) 417
Fnu4HI GCNGC 3 cut(s) 419, 422, 471
FokI GGATG 2 cut(s) 256, 593
Fsp4HI GCNGC 3 cut(s) 419, 422, 471
GluI GCNGC 3 cut(s) 419, 422, 471
HaeIII GGCC 1 cut(s) 383
HapII CCGG 2 cut(s) 22, 415
Hin1II CATG 3 cut(s) 499, 608, 628
HinfI GANTC 7 cut(s) 83, 104, 131, 137, 143, 167, 200
HpaII CCGG 2 cut(s) 22, 415
HphI GGTGA 1 cut(s) 35
Hpy166II GTNNAC 2 cut(s) 349, 440
Hpy188III TCNNGA 4 cut(s) 22, 80, 292, 366
Hpy8I GTNNAC 2 cut(s) 349, 440
Hpy99I CGWCG 2 cut(s) 74, 322
HpyAV CCTTC 2 cut(s) 328, 392
HpyCH4V TGCA 2 cut(s) 4, 349
HpyF10VI GCNNNNNNNGC 1 cut(s) 479
HpyF3I CTNAG 1 cut(s) 486
Hsp92II CATG 3 cut(s) 499, 608, 628
Kpn2I TCCGGA 1 cut(s) 21
Kzo9I GATC 9 cut(s) 18, 66, 76, 94, 314, 372, 449, 572, 601
LguI GCTCTTC 1 cut(s) 450
LmnI GCTCC 1 cut(s) 326
Lsp1109I GCAGC 1 cut(s) 482
LweI GCATC 2 cut(s) 13, 491
MalI GATC 9 cut(s) 20, 68, 78, 96, 316, 374, 451, 574, 603
MboI GATC 9 cut(s) 18, 66, 76, 94, 314, 372, 449, 572, 601
MboII GAAGA 4 cut(s) 176, 416, 467, 521
MflI RGATCY 2 cut(s) 18, 449
MhlI GDGCHC 1 cut(s) 351
MlsI TGGCCA 1 cut(s) 383
MluCI AATT 3 cut(s) 109, 205, 629
MluNI TGGCCA 1 cut(s) 383
MlyI GAGTC 1 cut(s) 137
MmeI TCCRAC 2 cut(s) 72, 165
MnlI CCTC 8 cut(s) 43, 46, 49, 67, 124, 265, 337, 427
Mox20I TGGCCA 1 cut(s) 383
Mph1103I ATGCAT 1 cut(s) 6
MroI TCCGGA 1 cut(s) 21
MscI TGGCCA 1 cut(s) 383
MseI TTAA 1 cut(s) 612
Msp20I TGGCCA 1 cut(s) 383
MspI CCGG 2 cut(s) 22, 415
MspR9I CCNGG 2 cut(s) 47, 88
MvaI CCWGG 2 cut(s) 47, 88
MwoI GCNNNNNNNGC 1 cut(s) 479
NdeII GATC 9 cut(s) 18, 66, 76, 94, 314, 372, 449, 572, 601
NlaIII CATG 3 cut(s) 499, 608, 628
NlaIV GGNNCC 2 cut(s) 60, 127
NsiI ATGCAT 1 cut(s) 6
PciSI GCTCTTC 1 cut(s) 450
PfeI GAWTC 6 cut(s) 83, 104, 131, 137, 167, 200
PkrI GCNGC 3 cut(s) 420, 423, 472
PleI GAGTC 1 cut(s) 137
PpsI GAGTC 1 cut(s) 137
PsiI TTATAA 1 cut(s) 652
Psp6I CCWGG 2 cut(s) 45, 86
PspGI CCWGG 2 cut(s) 45, 86
PspN4I GGNNCC 2 cut(s) 60, 127
PspPI GGNCC 1 cut(s) 440
PsuI RGATCY 2 cut(s) 18, 449
RsaI GTAC 2 cut(s) 278, 566
RsaNI GTAC 2 cut(s) 277, 565
SapI GCTCTTC 1 cut(s) 450
SaqAI TTAA 1 cut(s) 612
SatI GCNGC 3 cut(s) 419, 422, 471
Sau3AI GATC 9 cut(s) 18, 66, 76, 94, 314, 372, 449, 572, 601
Sau96I GGNCC 1 cut(s) 440
SchI GAGTC 1 cut(s) 137
ScrFI CCNGG 2 cut(s) 47, 88
SduI GDGCHC 1 cut(s) 351
SetI ASST 8 cut(s) 60, 299, 331, 339, 348, 389, 462, 475
SfaNI GCATC 2 cut(s) 13, 491
SgrAI CRCCGGYG 1 cut(s) 414
SinI GGWCC 1 cut(s) 440
Sse9I AATT 3 cut(s) 109, 205, 629
SsiI CCGC 4 cut(s) 324, 418, 421, 424
SspI AATATT 1 cut(s) 550
StyD4I CCNGG 2 cut(s) 45, 86
TaqI TCGA 4 cut(s) 72, 203, 317, 359
TasI AATT 3 cut(s) 109, 205, 629
TauI GCSGC 2 cut(s) 421, 424
TfiI GAWTC 6 cut(s) 83, 104, 131, 137, 167, 200
Tru1I TTAA 1 cut(s) 612
Tru9I TTAA 1 cut(s) 612
TseI GCWGC 1 cut(s) 470
TspDTI ATGAA 3 cut(s) 177, 411, 641
VneI GTGCAC 1 cut(s) 347
VpaK11BI GGWCC 1 cut(s) 440
XapI RAATTY 2 cut(s) 205, 629
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.