Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004514.1

Orthogroup ID

OG0018229

Physical Location & Seq

Genomic Coordinates Reverse (-)

90791 .. 91255

Gene Structure 465 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004514.1_g000021.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 465 bp

atgcatccccattcccagatccggattgacaccgatgattatcaccaggaggaggaggttcctatgatcatcgaggatcaagattcctggtcggatcgccccgaatccaattcctccgataccggttccgattccgattccgactcctgtgagcagattgatgaagattcggagtgtgattgggagagcgaaactgctgaatcgaattctattgatgattttggggtttttaccggaaatgggatgatgttcatagtgaatgatgtgagtgaggagtacgatagtattgtcaagagctttgctgtgggtatgggatcgacgggcggagctacgaaggttgtggaagtgcacaagaaatcgatttctggactgatcgggctggccaggtttgaaacattttgggttttttcgcaggccgtggggaaaaaatgtggtgagagagtgaggactcggaggaaagtgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PARP RST

Protein Analysis

154

Amino Acids

17.17

Weight (kDa)

4.33

Isoelectric Point (pI)

54.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018229)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000011102 RLG00000030025
rosa_multiflora	Rmu_sc0001839.1_g000014 Rmu_sc0004514.1_g000021 Rmu_sc0008320.1_g000002 Rmu_sc0014034.1_g000002
rosa_samantha	Rh2DG358600 Rh5BG080300 Rh5DG526300
rosa_wichuraiana	Rw0G009170 Rw7G028350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	21
AciI	CCGC	1 cut(s)	324
AclWI	GGATC	4 cut(s)	13, 84, 102, 322
AcoI	YGGCCR	1 cut(s)	381
AcsI	RAATTY	1 cut(s)	205
AfaI	GTAC	1 cut(s)	278
AfiI	CCNNNNNNNGG	3 cut(s)	21, 52, 240
AgeI	ACCGGT	1 cut(s)	122
AgsI	TTSAA	1 cut(s)	392
AjnI	CCWGG	3 cut(s)	45, 86, 383
AluBI	AGCT	2 cut(s)	297, 329
AluI	AGCT	2 cut(s)	297, 329
Alw21I	GWGCWC	1 cut(s)	351
Alw44I	GTGCAC	1 cut(s)	347
AlwI	GGATC	4 cut(s)	13, 84, 102, 322
Aor13HI	TCCGGA	1 cut(s)	21
AoxI	GGCC	2 cut(s)	381, 414
ApaLI	GTGCAC	1 cut(s)	347
ApoI	RAATTY	1 cut(s)	205
AsiGI	ACCGGT	1 cut(s)	122
AsuHPI	GGTGA	2 cut(s)	35, 446
BaeGI	GKGCMC	1 cut(s)	351
BalI	TGGCCA	1 cut(s)	383
Bbv12I	GWGCWC	1 cut(s)	351
BceAI	ACGGC	1 cut(s)	401
BciT130I	CCWGG	3 cut(s)	47, 88, 385
BclI	TGATCA	1 cut(s)	66
Bme1390I	CCNGG	3 cut(s)	47, 88, 385
BmiI	GGNNCC	2 cut(s)	60, 127
BmrFI	CCNGG	3 cut(s)	47, 88, 385
BmsI	GCATC	1 cut(s)	13
Bsa29I	ATCGAT	1 cut(s)	359
BsaBI	GATNNNNATC	1 cut(s)	39
BsaJI	CCNNGG	1 cut(s)	417
BsaWI	WCCGGW	3 cut(s)	21, 122, 233
Bsc4I	CCNNNNNNNGG	3 cut(s)	21, 52, 240
Bse118I	RCCGGY	1 cut(s)	122
Bse8I	GATNNNNATC	1 cut(s)	39
BseAI	TCCGGA	1 cut(s)	21
BseBI	CCWGG	3 cut(s)	47, 88, 385
BseCI	ATCGAT	1 cut(s)	359
BseDI	CCNNGG	1 cut(s)	417
BseGI	GGATG	2 cut(s)	4, 249
BseJI	GATNNNNATC	1 cut(s)	39
BseLI	CCNNNNNNNGG	3 cut(s)	21, 52, 240
BseRI	GAGGAG	3 cut(s)	65, 68, 287
BseSI	GKGCMC	1 cut(s)	351
BshFI	GGCC	2 cut(s)	383, 416
BshTI	ACCGGT	1 cut(s)	122
BshVI	ATCGAT	1 cut(s)	359
BsiHKAI	GWGCWC	1 cut(s)	351
BsiSI	CCGG	3 cut(s)	22, 123, 234
BslI	CCNNNNNNNGG	3 cut(s)	21, 52, 240
BsnI	GGCC	2 cut(s)	383, 416
Bsp1286I	GDGCHC	1 cut(s)	351
Bsp13I	TCCGGA	1 cut(s)	21
Bsp143I	GATC	6 cut(s)	18, 66, 76, 94, 314, 372
BspACI	CCGC	1 cut(s)	324
BspANI	GGCC	2 cut(s)	383, 416
BspDI	ATCGAT	1 cut(s)	359
BspEI	TCCGGA	1 cut(s)	21
BspLI	GGNNCC	2 cut(s)	60, 127
BspPI	GGATC	4 cut(s)	13, 84, 102, 322
BsrFI	RCCGGY	1 cut(s)	122
BssAI	RCCGGY	1 cut(s)	122
BssECI	CCNNGG	1 cut(s)	417
BssMI	GATC	6 cut(s)	18, 66, 76, 94, 314, 372
Bst2UI	CCWGG	3 cut(s)	47, 88, 385
BstC8I	GCNNGC	2 cut(s)	381, 414
BstDSI	CCRYGG	1 cut(s)	417
BstF5I	GGATG	2 cut(s)	4, 249
BstKTI	GATC	6 cut(s)	21, 69, 79, 97, 317, 375
BstMBI	GATC	6 cut(s)	18, 66, 76, 94, 314, 372
BstNI	CCWGG	3 cut(s)	47, 88, 385
BstSCI	CCNGG	3 cut(s)	45, 86, 383
BstSLI	GKGCMC	1 cut(s)	351
BstX2I	RGATCY	1 cut(s)	18
BstYI	RGATCY	1 cut(s)	18
Bsu15I	ATCGAT	1 cut(s)	359
BsuRI	GGCC	2 cut(s)	383, 416
BsuTUI	ATCGAT	1 cut(s)	359
BtgI	CCRYGG	1 cut(s)	417
BtsCI	GGATG	2 cut(s)	4, 249
Cac8I	GCNNGC	2 cut(s)	381, 414
Cfr10I	RCCGGY	1 cut(s)	122
ClaI	ATCGAT	1 cut(s)	359
Csp6I	GTAC	1 cut(s)	277
CspAI	ACCGGT	1 cut(s)	122
CviJI	RGCY	5 cut(s)	297, 329, 379, 383, 416
CviKI_1	RGCY	5 cut(s)	297, 329, 379, 383, 416
CviQI	GTAC	1 cut(s)	277
DpnI	GATC	6 cut(s)	20, 68, 78, 96, 316, 374
DpnII	GATC	6 cut(s)	18, 66, 76, 94, 314, 372
EaeI	YGGCCR	1 cut(s)	381
EciI	GGCGGA	1 cut(s)	339
EcoRI	GAATTC	1 cut(s)	205
EcoRII	CCWGG	3 cut(s)	45, 86, 383
EcoT22I	ATGCAT	1 cut(s)	6
FaiI	YATR	3 cut(s)	65, 254, 311
FbaI	TGATCA	1 cut(s)	66
FokI	GGATG	1 cut(s)	256
HaeIII	GGCC	2 cut(s)	383, 416
HapII	CCGG	3 cut(s)	22, 123, 234
HinfI	GANTC	8 cut(s)	83, 104, 131, 137, 143, 167, 200, 448
HpaII	CCGG	3 cut(s)	22, 123, 234
HphI	GGTGA	2 cut(s)	35, 446
Hpy166II	GTNNAC	1 cut(s)	349
Hpy188I	TCNGA	7 cut(s)	94, 118, 130, 136, 142, 172, 453
Hpy188III	TCNNGA	4 cut(s)	22, 80, 292, 366
Hpy8I	GTNNAC	1 cut(s)	349
Hpy99I	CGWCG	1 cut(s)	322
HpyAV	CCTTC	1 cut(s)	328
HpyCH4V	TGCA	2 cut(s)	4, 349
Kpn2I	TCCGGA	1 cut(s)	21
Ksp22I	TGATCA	1 cut(s)	66
Kzo9I	GATC	6 cut(s)	18, 66, 76, 94, 314, 372
LmnI	GCTCC	1 cut(s)	326
LweI	GCATC	1 cut(s)	13
MalI	GATC	6 cut(s)	20, 68, 78, 96, 316, 374
MboI	GATC	6 cut(s)	18, 66, 76, 94, 314, 372
MboII	GAAGA	1 cut(s)	176
MflI	RGATCY	1 cut(s)	18
MhlI	GDGCHC	1 cut(s)	351
MlsI	TGGCCA	1 cut(s)	383
MluCI	AATT	2 cut(s)	109, 205
MluNI	TGGCCA	1 cut(s)	383
MlyI	GAGTC	2 cut(s)	137, 442
MmeI	TCCRAC	2 cut(s)	72, 165
MnlI	CCTC	8 cut(s)	43, 46, 49, 67, 124, 265, 438, 447
Mox20I	TGGCCA	1 cut(s)	383
Mph1103I	ATGCAT	1 cut(s)	6
MroI	TCCGGA	1 cut(s)	21
MscI	TGGCCA	1 cut(s)	383
Msp20I	TGGCCA	1 cut(s)	383
MspI	CCGG	3 cut(s)	22, 123, 234
MspR9I	CCNGG	3 cut(s)	47, 88, 385
MvaI	CCWGG	3 cut(s)	47, 88, 385
NdeII	GATC	6 cut(s)	18, 66, 76, 94, 314, 372
NlaIV	GGNNCC	2 cut(s)	60, 127
NsiI	ATGCAT	1 cut(s)	6
PfeI	GAWTC	6 cut(s)	83, 104, 131, 137, 167, 200
PinAI	ACCGGT	1 cut(s)	122
PleI	GAGTC	2 cut(s)	137, 442
PpsI	GAGTC	2 cut(s)	137, 442
Psp6I	CCWGG	3 cut(s)	45, 86, 383
PspGI	CCWGG	3 cut(s)	45, 86, 383
PspN4I	GGNNCC	2 cut(s)	60, 127
PsuI	RGATCY	1 cut(s)	18
RsaI	GTAC	1 cut(s)	278
RsaNI	GTAC	1 cut(s)	277
Sau3AI	GATC	6 cut(s)	18, 66, 76, 94, 314, 372
SchI	GAGTC	2 cut(s)	137, 442
ScrFI	CCNGG	3 cut(s)	47, 88, 385
SduI	GDGCHC	1 cut(s)	351
SetI	ASST	5 cut(s)	60, 299, 331, 339, 389
SfaNI	GCATC	1 cut(s)	13
Sse9I	AATT	2 cut(s)	109, 205
SsiI	CCGC	1 cut(s)	324
StyD4I	CCNGG	3 cut(s)	45, 86, 383
TaqI	TCGA	4 cut(s)	72, 203, 317, 359
TasI	AATT	2 cut(s)	109, 205
TfiI	GAWTC	6 cut(s)	83, 104, 131, 137, 167, 200
TspDTI	ATGAA	2 cut(s)	177, 241
VneI	GTGCAC	1 cut(s)	347
XapI	RAATTY	1 cut(s)	205
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.