Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001969.1

Orthogroup ID

OG0017835

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 838

Gene Structure 838 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 377 bp

gaactctcagcatttctactggtggatttgggaataatcaagtgtatccaacttacaagtgcatagcttcagaacaaattttctcagctcgagatgacttgcttggctatgaagaggtgtccttttatctttatgcaaaagtattgatgcccacgcttgcctttactatatctaatggttttgctttgcaggctattgaagtggcacaaatagttgatgaacctcttgatggaagcaacactggattcgtcttaaagtgcataaaaatagctgattcccatttatccaatccggttcaatccttgacctctgaatcaatggctccattcctttcccacttttcagcaacattgtctactcaaaagtggttttactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000280 GO:0003674 GO:0003676 GO:0003677 GO:0003824 GO:0004518 GO:0004519 GO:0004520 GO:0004527 GO:0004536 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006139 GO:0006259 GO:0006281 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0006996 GO:0007049 GO:0007059 GO:0007127 GO:0007129 GO:0008150 GO:0008152 GO:0008409 GO:0009987 GO:0016043 GO:0016787 GO:0016788 GO:0016888 GO:0016893 GO:0017108 GO:0022402 GO:0022414 GO:0033554 GO:0034641 GO:0036297 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044260 GO:0044424 GO:0044464 GO:0045132 GO:0045143 GO:0046483 GO:0048256 GO:0048285 GO:0050896 GO:0051276 GO:0051321 GO:0051716 GO:0061982 GO:0070192 GO:0070336 GO:0071704 GO:0071840 GO:0090304 GO:0090305 GO:0097159 GO:0098813 GO:0140013 GO:0140097 GO:1901360 GO:1901363 GO:1903046

KEGG Pathways

Metabolic & Signaling

ko03460 map03460

Pfam Domains

Protein Families

HIRAN VRR_NUC

Protein Analysis

124

Amino Acids

13.62

Weight (kDa)

4.71

Isoelectric Point (pI)

35.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017835)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000003654 RLG00000008421 RLG00000014808
rosa_multiflora	Rmu_sc0001969.1_g000001
rosa_roxburghii	Rroxscaffold_180G00433330 Rroxscaffold_6G00407280 Rroxscaffold_7G00213750
rosa_rugosa	Rorug04G0114200
rosa_samantha	Rh1DG108800 Rh4CG173200 Rh4DG156500
rosa_wichuraiana	Rw4G013440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	355
AcsI	RAATTY	1 cut(s)	77
AcuI	CTGAAG	1 cut(s)	53
AfiI	CCNNNNNNNGG	1 cut(s)	229
AgsI	TTSAA	2 cut(s)	199, 298
AluBI	AGCT	3 cut(s)	67, 88, 271
AluI	AGCT	3 cut(s)	67, 88, 271
Ama87I	CYCGRG	1 cut(s)	89
ApoI	RAATTY	1 cut(s)	77
AvaI	CYCGRG	1 cut(s)	89
BccI	CCATC	1 cut(s)	223
BciVI	GTATCC	1 cut(s)	56
BfaI	CTAG	1 cut(s)	375
BfuI	GTATCC	1 cut(s)	56
BmeT110I	CYCGRG	1 cut(s)	89
BmiI	GGNNCC	1 cut(s)	323
BmsI	GCATC	1 cut(s)	137
BsaWI	WCCGGW	1 cut(s)	291
Bsc4I	CCNNNNNNNGG	1 cut(s)	229
Bse1I	ACTGG	2 cut(s)	24, 246
BseLI	CCNNNNNNNGG	1 cut(s)	229
BseMII	CTCAG	2 cut(s)	21, 98
BseNI	ACTGG	2 cut(s)	24, 246
BsiHKCI	CYCGRG	1 cut(s)	89
BsiSI	CCGG	1 cut(s)	292
BslI	CCNNNNNNNGG	1 cut(s)	229
BsoBI	CYCGRG	1 cut(s)	89
BspCNI	CTCAG	2 cut(s)	20, 97
BspLI	GGNNCC	1 cut(s)	323
BsrI	ACTGG	2 cut(s)	24, 246
Bst6I	CTCTTC	1 cut(s)	107
BstC8I	GCNNGC	2 cut(s)	158, 191
BstDEI	CTNAG	2 cut(s)	7, 84
BstMWI	GCNNNNNNNGC	1 cut(s)	190
BsuI	GTATCC	1 cut(s)	56
BtsIMutI	CAGTG	1 cut(s)	239
Cac8I	GCNNGC	2 cut(s)	158, 191
CviJI	RGCY	6 cut(s)	67, 88, 107, 193, 271, 322
CviKI_1	RGCY	6 cut(s)	67, 88, 107, 193, 271, 322
DdeI	CTNAG	2 cut(s)	7, 84
Eam1104I	CTCTTC	1 cut(s)	107
EarI	CTCTTC	1 cut(s)	107
Eco57I	CTGAAG	1 cut(s)	53
Eco88I	CYCGRG	1 cut(s)	89
FaiI	YATR	5 cut(s)	64, 110, 134, 169, 262
FblI	GTMKAC	1 cut(s)	355
FspBI	CTAG	1 cut(s)	375
HapII	CCGG	1 cut(s)	292
HinfI	GANTC	3 cut(s)	245, 274, 313
HpaII	CCGG	1 cut(s)	292
Hpy166II	GTNNAC	1 cut(s)	356
Hpy188I	TCNGA	2 cut(s)	72, 312
Hpy188III	TCNNGA	2 cut(s)	91, 226
Hpy8I	GTNNAC	1 cut(s)	356
HpyCH4V	TGCA	4 cut(s)	62, 136, 189, 260
HpyF10VI	GCNNNNNNNGC	1 cut(s)	190
HpyF3I	CTNAG	2 cut(s)	7, 84
LmnI	GCTCC	1 cut(s)	327
LpnPI	CCDG	4 cut(s)	5, 175, 227, 305
LweI	GCATC	1 cut(s)	137
MaeI	CTAG	1 cut(s)	375
MboII	GAAGA	1 cut(s)	124
MluCI	AATT	1 cut(s)	77
MmeI	TCCRAC	1 cut(s)	73
MnlI	CCTC	3 cut(s)	108, 233, 318
MseI	TTAA	1 cut(s)	253
MspI	CCGG	1 cut(s)	292
MwoI	GCNNNNNNNGC	1 cut(s)	190
NlaIV	GGNNCC	1 cut(s)	323
PaeR7I	CTCGAG	1 cut(s)	89
PfeI	GAWTC	3 cut(s)	245, 274, 313
PspN4I	GGNNCC	1 cut(s)	323
SaqAI	TTAA	1 cut(s)	253
SetI	ASST	6 cut(s)	69, 90, 119, 225, 273, 310
SfaNI	GCATC	1 cut(s)	137
Sfr274I	CTCGAG	1 cut(s)	89
SlaI	CTCGAG	1 cut(s)	89
SmlI	CTYRAG	1 cut(s)	89
SmoI	CTYRAG	1 cut(s)	89
Sse9I	AATT	1 cut(s)	77
SspMI	CTAG	1 cut(s)	375
TaqI	TCGA	1 cut(s)	90
TasI	AATT	1 cut(s)	77
TfiI	GAWTC	3 cut(s)	245, 274, 313
Tru1I	TTAA	1 cut(s)	253
Tru9I	TTAA	1 cut(s)	253
TscAI	CASTG	1 cut(s)	246
TspDTI	ATGAA	2 cut(s)	125, 233
TspRI	CASTG	1 cut(s)	246
XapI	RAATTY	1 cut(s)	77
XhoI	CTCGAG	1 cut(s)	89
XmiI	GTMKAC	1 cut(s)	355
XspI	CTAG	1 cut(s)	375

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.