Rmu_sc0002045.1_g000001

HEAT repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002045.1
Physical Location & Seq
Reverse (-)
248 .. 2669
2422 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002045.1_g000001.1.cds

Sequence Viewer

Length: 417 bp
atgattgccacaaaactcatcaagtttcatgaggaatttgtgagacaagaggctttatatatgcttcaaaatgctttggaagggtctggtggtagtgctgctgcttcagcatacacggaggcatttcgtctcatcatgcggtttgctgttggtgataaatcatttcttgtcagaatcgctgctgcaagatgtttgaaggcatttgctattattggaggaccggaagcattgggttcgctgcttgctcttggaatgaatcctgatgcacaggcaattcgtttgaagtacttgcatccagacagtgagcttcaaaactatgcaattcaggttatggacatgcttcgtgccgatacttctgttgacgcctacactctggcattcttcaaacaaattcttgagcttaactcttacatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

15.23

Weight (kDa)

6.09

Isoelectric Point (pI)

26.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 139
AcsI RAATTY 2 cut(s) 35, 390
AcuI CTGAAG 1 cut(s) 90
AcyI GRCGYC 1 cut(s) 363
AfaI GTAC 1 cut(s) 287
AgsI TTSAA 5 cut(s) 68, 196, 283, 311, 385
AluBI AGCT 2 cut(s) 307, 400
AluI AGCT 2 cut(s) 307, 400
Alw26I GTCTC 2 cut(s) 37, 134
ApeKI GCWGC 5 cut(s) 98, 101, 179, 182, 238
ApoI RAATTY 2 cut(s) 35, 390
AspS9I GGNCC 1 cut(s) 218
AsuHPI GGTGA 1 cut(s) 164
AvaII GGWCC 1 cut(s) 218
BaeI ACNNNNGTAYC 2 cut(s) 342, 375
BbvI GCAGC 5 cut(s) 85, 88, 166, 169, 225
BcgI CGANNNNNNTGC 2 cut(s) 216, 250
BcoDI GTCTC 2 cut(s) 37, 134
BisI GCNGC 5 cut(s) 99, 102, 180, 183, 239
BlsI GCNGC 5 cut(s) 100, 103, 181, 184, 240
BmcAI AGTACT 1 cut(s) 287
Bme18I GGWCC 1 cut(s) 218
BmgT120I GGNCC 1 cut(s) 218
BmsI GCATC 2 cut(s) 253, 301
BplI GAGNNNNNCTC 1 cut(s) 389
BpuEI CTTGAG 1 cut(s) 416
BsaHI GRCGYC 1 cut(s) 363
BsaWI WCCGGW 1 cut(s) 220
BseGI GGATG 1 cut(s) 292
BseXI GCAGC 5 cut(s) 85, 88, 166, 169, 225
BsiSI CCGG 1 cut(s) 221
BsmAI GTCTC 2 cut(s) 37, 134
BsmBI CGTCTC 1 cut(s) 134
BsmI GAATGC 1 cut(s) 377
BspACI CCGC 1 cut(s) 139
BspHI TCATGA 1 cut(s) 28
BssNI GRCGYC 1 cut(s) 363
Bst4CI ACNGT 1 cut(s) 302
BstACI GRCGYC 1 cut(s) 363
BstC8I GCNNGC 1 cut(s) 243
BstF5I GGATG 1 cut(s) 292
BstMAI GTCTC 2 cut(s) 37, 134
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstNSI RCATGY 1 cut(s) 340
BstV1I GCAGC 5 cut(s) 85, 88, 166, 169, 225
BtsCI GGATG 1 cut(s) 292
BtsIMutI CAGTG 1 cut(s) 307
Cac8I GCNNGC 1 cut(s) 243
CciI TCATGA 1 cut(s) 28
Cfr13I GGNCC 1 cut(s) 218
CseI GACGC 1 cut(s) 371
Csp6I GTAC 1 cut(s) 286
CviAII CATG 3 cut(s) 29, 136, 337
CviJI RGCY 3 cut(s) 53, 307, 400
CviKI_1 RGCY 3 cut(s) 53, 307, 400
CviQI GTAC 1 cut(s) 286
Eco47I GGWCC 1 cut(s) 218
Eco57I CTGAAG 1 cut(s) 90
Esp3I CGTCTC 1 cut(s) 134
FaeI CATG 3 cut(s) 32, 139, 340
FaiI YATR 9 cut(s) 30, 58, 60, 62, 112, 137, 318, 332, 338
FatI CATG 3 cut(s) 28, 135, 336
Fnu4HI GCNGC 5 cut(s) 99, 102, 180, 183, 239
FokI GGATG 1 cut(s) 279
Fsp4HI GCNGC 5 cut(s) 99, 102, 180, 183, 239
GluI GCNGC 5 cut(s) 99, 102, 180, 183, 239
HapII CCGG 1 cut(s) 221
HgaI GACGC 1 cut(s) 371
Hin1I GRCGYC 1 cut(s) 363
Hin1II CATG 3 cut(s) 32, 139, 340
HincII GTYRAC 1 cut(s) 361
HindII GTYRAC 1 cut(s) 361
HinfI GANTC 2 cut(s) 174, 256
HpaII CCGG 1 cut(s) 221
HphI GGTGA 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 361
Hpy188I TCNGA 1 cut(s) 173
Hpy188III TCNNGA 4 cut(s) 29, 260, 296, 395
Hpy8I GTNNAC 1 cut(s) 361
HpyAV CCTTC 2 cut(s) 74, 190
HpyCH4III ACNGT 1 cut(s) 302
HpyCH4V TGCA 4 cut(s) 185, 266, 292, 320
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
Hsp92I GRCGYC 1 cut(s) 363
Hsp92II CATG 3 cut(s) 32, 139, 340
LpnPI CCDG 7 cut(s) 72, 234, 254, 273, 309, 311, 359
Lsp1109I GCAGC 5 cut(s) 85, 88, 166, 169, 225
LweI GCATC 2 cut(s) 253, 301
MboII GAAGA 1 cut(s) 373
MluCI AATT 4 cut(s) 35, 273, 321, 390
MnlI CCTC 4 cut(s) 25, 43, 112, 209
MseI TTAA 1 cut(s) 402
MspI CCGG 1 cut(s) 221
Mva1269I GAATGC 1 cut(s) 377
MwoI GCNNNNNNNGC 1 cut(s) 107
NlaIII CATG 3 cut(s) 32, 139, 340
NspI RCATGY 1 cut(s) 340
PagI TCATGA 1 cut(s) 28
PctI GAATGC 1 cut(s) 377
PfeI GAWTC 2 cut(s) 174, 256
PkrI GCNGC 5 cut(s) 100, 103, 181, 184, 240
PspPI GGNCC 1 cut(s) 218
RsaI GTAC 1 cut(s) 287
RsaNI GTAC 1 cut(s) 286
SaqAI TTAA 1 cut(s) 402
SatI GCNGC 5 cut(s) 99, 102, 180, 183, 239
Sau96I GGNCC 1 cut(s) 218
ScaI AGTACT 1 cut(s) 287
SetI ASST 3 cut(s) 309, 330, 402
SfaNI GCATC 2 cut(s) 253, 301
SinI GGWCC 1 cut(s) 218
SmlI CTYRAG 1 cut(s) 395
SmoI CTYRAG 1 cut(s) 395
Sse9I AATT 4 cut(s) 35, 273, 321, 390
SsiI CCGC 1 cut(s) 139
TaaI ACNGT 1 cut(s) 302
TasI AATT 4 cut(s) 35, 273, 321, 390
TatI WGTACW 1 cut(s) 285
TfiI GAWTC 2 cut(s) 174, 256
Tru1I TTAA 1 cut(s) 402
Tru9I TTAA 1 cut(s) 402
TscAI CASTG 1 cut(s) 307
TseI GCWGC 5 cut(s) 98, 101, 179, 182, 238
TspDTI ATGAA 2 cut(s) 17, 269
TspGWI ACGGA 1 cut(s) 131
TspRI CASTG 1 cut(s) 307
VpaK11BI GGWCC 1 cut(s) 218
XapI RAATTY 2 cut(s) 35, 390
XceI RCATGY 1 cut(s) 340
ZrmI AGTACT 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.