Rmu_sc0002121.1_g000003

Core-2/I-Branching enzyme

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002121.1
OG0016847
Physical Location & Seq
Reverse (-)
9189 .. 13146
3958 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002121.1_g000003.1.cds

Sequence Viewer

Length: 1464 bp
atgaagaaccagcagcaacaaaacccaccaccctgttttctcaaacacttcgtcaaggctcaaatgcaaatcaacaagatcatctctattttcctcatctttgtctctggccttgcccttggaatcaccctaagcttctacatcaaagacacccctcttcaaatctacactgcattagcgcaagcgaaaaccaatttcgattccaccatatacaaattagtccctatagattctcccccaccaccaccaccatcttctcctgttaaaaatgaaaccaatatcaccaccaaacccctctcttcaccgccgcctcctccgccagtcgagttgaaaaattacgtaaaggtgccaagtgccatgcatggtatggaggattctgagttattgtggagagcttcgatggtgccaaaaagaagtggggcattgccattcaagaacaccaagccaaaagtggccttcatgtttttgaccagaggggatttggctttggctcctttatgggaacgtttctttaaaggaaatgaagggctttactctatctacgtccatgccagtccaacttccggcgagacaatgccggaaaattctgtgtttcacggcagaagagtcccgagtaagaatgtgacgtggggtgagccaaacatggtgcaagcagagcgccgcctactagccaatgcactgctggacttgtccaaccaacgtttcattcttctctcggagtcgtgcataccactattcaacttcaaaacggtctatgattacgttatggactcaaccaaaacatttgtggaggcctacgacttgcccggtccagtgggccgagacagatataggaaacaaatgagcccaacaatcaagcttgagcaatggcggaaggggtcgcagtggttcgaggtggaccgccagttggcactggaggtggtttcggacagacggtattttccgctgtttgagaagtactgcgtcccctcgtgctactcggatgagcactacttgcctacttacatgagcatcaaattttggaagaaaaactcgaaccggactttgcattgggttgactggtcgagaggggggccacatccgtcgaggtatcagaggacggatgtgactcatgagttcttgagcaagatgagatttggaacaacatgtgagtacaatgggaacaacactaacatatgtcatttgtttgcaagaaagttcatgccttacatgagcatcaaattttggaagaaaaactcgaaccggactttgcattgggttgactggtcgagaggggggccacatccgtcgaggtatcagaggacggatgtgactcatgagttcttgagcaagatgagatttggaacaacatgtgagtacaatgggaacaacactaacatatgtcatttgtttgcaaggaagttcatgcctaacactttggataggcttttgaggtttgctcccaagctcatgcaattcgattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Branch

Protein Analysis

487

Amino Acids

56.58

Weight (kDa)

9.64

Isoelectric Point (pI)

47.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016847)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g11810
malus_domestica MD14G1228400.v1.1 MD14G1228500.v1.1
prunus_persica Prupe.5G223500_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0185791
rosa_laevigata RLG00000004883
rosa_multiflora Rmu_co8078508.1_g000001 Rmu_sc0002121.1_g000003
rosa_rugosa Rorug06G0471300
rosa_samantha Rh7AG071000 Rh7BG076800 Rh7CG076800 Rh7DG076700
rosa_wichuraiana Rw7G006400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 346, 403
AciI CCGC 7 cut(s) 305, 308, 317, 661, 871, 901, 944
AclI AACGTT 2 cut(s) 505, 700
AcsI RAATTY 3 cut(s) 583, 1016, 1220
AfaI GTAC 3 cut(s) 959, 1154, 1358
AfiI CCNNNNNNNGG 2 cut(s) 563, 907
AflIII ACRYGT 2 cut(s) 1145, 1349
AgsI TTSAA 5 cut(s) 161, 331, 433, 739, 745
AjiI CACGTC 1 cut(s) 627
AjuI GAANNNNNNNTTGG 4 cut(s) 686, 690, 718, 722
AluBI AGCT 4 cut(s) 135, 395, 859, 1447
AluI AGCT 4 cut(s) 135, 395, 859, 1447
Alw21I GWGCWC 1 cut(s) 990
Alw26I GTCTC 3 cut(s) 109, 563, 816
Ama87I CYCGRG 1 cut(s) 610
AoxI GGCC 6 cut(s) 109, 453, 792, 817, 1073, 1277
ApeKI GCWGC 1 cut(s) 13
ApoI RAATTY 3 cut(s) 583, 1016, 1220
ArsI GACNNNNNNTTYG 2 cut(s) 36, 68
AspLEI GCGC 2 cut(s) 181, 660
AspS9I GGNCC 5 cut(s) 809, 817, 898, 1073, 1277
AsuC2I CCSGG 1 cut(s) 807
AsuHPI GGTGA 4 cut(s) 118, 274, 294, 644
AvaI CYCGRG 1 cut(s) 610
AvaII GGWCC 2 cut(s) 809, 898
BanI GGYRCC 2 cut(s) 346, 403
BanII GRGCYC 1 cut(s) 848
BauI CACGAG 1 cut(s) 970
Bbv12I GWGCWC 1 cut(s) 990
BbvI GCAGC 1 cut(s) 25
BccI CCATC 2 cut(s) 259, 394
BceAI ACGGC 1 cut(s) 613
BcnI CCSGG 1 cut(s) 807
BcoDI GTCTC 3 cut(s) 109, 563, 816
BfaI CTAG 1 cut(s) 668
BfmI CTRYAG 1 cut(s) 225
BfoI RGCGCY 1 cut(s) 661
BisI GCNGC 3 cut(s) 14, 308, 661
BlsI GCNGC 3 cut(s) 15, 309, 662
BmcAI AGTACT 1 cut(s) 959
Bme1390I CCNGG 1 cut(s) 807
Bme18I GGWCC 2 cut(s) 809, 898
BmeT110I CYCGRG 1 cut(s) 610
BmgBI CACGTC 1 cut(s) 627
BmgT120I GGNCC 5 cut(s) 809, 817, 898, 1073, 1277
BmiI GGNNCC 5 cut(s) 348, 405, 492, 1074, 1278
BmrFI CCNGG 1 cut(s) 807
BmsI GCATC 2 cut(s) 1020, 1224
BplI GAGNNNNNCTC 2 cut(s) 1423, 1455
BpmI CTGGAG 1 cut(s) 935
Bpu10I CCTNAGC 1 cut(s) 131
BpuEI CTTGAG 3 cut(s) 881, 1141, 1345
BpuMI CCSGG 1 cut(s) 807
BsaAI YACGTR 1 cut(s) 340
BsaJI CCNNGG 1 cut(s) 118
BsaWI WCCGGW 2 cut(s) 1038, 1242
Bsc4I CCNNNNNNNGG 2 cut(s) 563, 907
Bse1I ACTGG 7 cut(s) 320, 552, 812, 904, 918, 1064, 1268
Bse3DI GCAATG 2 cut(s) 422, 872
BseDI CCNNGG 1 cut(s) 118
BseGI GGATG 5 cut(s) 988, 1078, 1108, 1282, 1312
BseLI CCNNNNNNNGG 2 cut(s) 563, 907
BseMI GCAATG 2 cut(s) 422, 872
BseMII CTCAG 1 cut(s) 369
BseNI ACTGG 7 cut(s) 320, 552, 812, 904, 918, 1064, 1268
BseRI GAGGAG 1 cut(s) 303
BseXI GCAGC 1 cut(s) 25
BshFI GGCC 6 cut(s) 111, 455, 794, 819, 1075, 1279
BshNI GGYRCC 2 cut(s) 346, 403
BsiHKAI GWGCWC 1 cut(s) 990
BsiHKCI CYCGRG 1 cut(s) 610
BsiSI CCGG 5 cut(s) 564, 578, 807, 1039, 1243
BslFI GGGAC 3 cut(s) 206, 593, 950
BslI CCNNNNNNNGG 2 cut(s) 563, 907
BsmAI GTCTC 3 cut(s) 109, 563, 816
BsmFI GGGAC 3 cut(s) 206, 593, 950
BsnI GGCC 6 cut(s) 111, 455, 794, 819, 1075, 1279
BsoBI CYCGRG 1 cut(s) 610
Bsp1286I GDGCHC 2 cut(s) 848, 990
Bsp143I GATC 1 cut(s) 78
BspACI CCGC 7 cut(s) 305, 308, 317, 661, 871, 901, 944
BspANI GGCC 6 cut(s) 111, 455, 794, 819, 1075, 1279
BspCNI CTCAG 1 cut(s) 370
BspHI TCATGA 2 cut(s) 1111, 1315
BspLI GGNNCC 5 cut(s) 348, 405, 492, 1074, 1278
BspT107I GGYRCC 2 cut(s) 346, 403
BsrDI GCAATG 2 cut(s) 422, 872
BsrI ACTGG 7 cut(s) 320, 552, 812, 904, 918, 1064, 1268
BssECI CCNNGG 1 cut(s) 118
BssMI GATC 1 cut(s) 78
BssSI CACGAG 1 cut(s) 970
BssT1I CCWWGG 1 cut(s) 118
Bst2BI CACGAG 1 cut(s) 970
Bst4CI ACNGT 2 cut(s) 751, 936
Bst6I CTCTTC 3 cut(s) 162, 304, 598
BstAPI GCANNNNNTGC 1 cut(s) 994
BstBAI YACGTR 1 cut(s) 340
BstC8I GCNNGC 2 cut(s) 183, 651
BstDEI CTNAG 2 cut(s) 131, 378
BstF5I GGATG 5 cut(s) 988, 1078, 1108, 1282, 1312
BstH2I RGCGCY 1 cut(s) 661
BstHHI GCGC 2 cut(s) 181, 660
BstKTI GATC 1 cut(s) 81
BstMAI GTCTC 3 cut(s) 109, 563, 816
BstMBI GATC 1 cut(s) 78
BstMWI GCNNNNNNNGC 3 cut(s) 316, 655, 994
BstNSI RCATGY 2 cut(s) 1149, 1353
BstSCI CCNGG 1 cut(s) 805
BstSFI CTRYAG 1 cut(s) 225
BstSNI TACGTA 1 cut(s) 340
BstV1I GCAGC 1 cut(s) 25
BsuRI GGCC 6 cut(s) 111, 455, 794, 819, 1075, 1279
BtrI CACGTC 1 cut(s) 627
BtsCI GGATG 5 cut(s) 988, 1078, 1108, 1282, 1312
BtsI GCAGTG 3 cut(s) 168, 677, 890
BtsIMutI CAGTG 5 cut(s) 168, 677, 819, 890, 911
Cac8I GCNNGC 2 cut(s) 183, 651
CciI TCATGA 2 cut(s) 1111, 1315
CfoI GCGC 2 cut(s) 181, 660
Cfr13I GGNCC 5 cut(s) 809, 817, 898, 1073, 1277
CseI GACGC 1 cut(s) 952
Csp6I GTAC 3 cut(s) 958, 1153, 1357
CviQI GTAC 3 cut(s) 958, 1153, 1357
DdeI CTNAG 2 cut(s) 131, 378
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
DraI TTTAAA 1 cut(s) 514
Eam1104I CTCTTC 3 cut(s) 162, 304, 598
EarI CTCTTC 3 cut(s) 162, 304, 598
EciI GGCGGA 2 cut(s) 306, 886
Eco105I TACGTA 1 cut(s) 340
Eco130I CCWWGG 1 cut(s) 118
Eco147I AGGCCT 1 cut(s) 794
Eco24I GRGCYC 1 cut(s) 848
Eco47I GGWCC 2 cut(s) 809, 898
Eco88I CYCGRG 1 cut(s) 610
EcoT14I CCWWGG 1 cut(s) 118
EcoT22I ATGCAT 1 cut(s) 363
EcoT38I GRGCYC 1 cut(s) 848
ErhI CCWWGG 1 cut(s) 118
FaqI GGGAC 3 cut(s) 206, 593, 950
FauNDI CATATG 2 cut(s) 1175, 1379
Fnu4HI GCNGC 3 cut(s) 14, 308, 661
FokI GGATG 5 cut(s) 995, 1065, 1115, 1269, 1319
FriOI GRGCYC 1 cut(s) 848
Fsp4HI GCNGC 3 cut(s) 14, 308, 661
FspBI CTAG 1 cut(s) 668
GlaI GCGC 2 cut(s) 180, 659
GluI GCNGC 3 cut(s) 14, 308, 661
GsuI CTGGAG 1 cut(s) 935
HaeII RGCGCY 1 cut(s) 661
HaeIII GGCC 6 cut(s) 111, 455, 794, 819, 1075, 1279
HapII CCGG 5 cut(s) 564, 578, 807, 1039, 1243
HgaI GACGC 1 cut(s) 952
HhaI GCGC 2 cut(s) 181, 660
Hin6I GCGC 2 cut(s) 179, 658
HinP1I GCGC 2 cut(s) 179, 658
HincII GTYRAC 2 cut(s) 1057, 1261
HindII GTYRAC 2 cut(s) 1057, 1261
HindIII AAGCTT 2 cut(s) 133, 857
HinfI GANTC 9 cut(s) 123, 200, 230, 374, 606, 719, 770, 1108, 1312
HpaII CCGG 5 cut(s) 564, 578, 807, 1039, 1243
HphI GGTGA 4 cut(s) 118, 274, 294, 644
Hpy166II GTNNAC 3 cut(s) 898, 1057, 1261
Hpy188I TCNGA 6 cut(s) 379, 718, 928, 982, 1095, 1299
Hpy188III TCNNGA 8 cut(s) 433, 610, 1065, 1112, 1120, 1269, 1316, 1324
Hpy8I GTNNAC 3 cut(s) 898, 1057, 1261
Hpy99I CGWCG 2 cut(s) 1087, 1291
HpyAV CCTTC 3 cut(s) 466, 518, 868
HpyCH4III ACNGT 2 cut(s) 751, 936
HpyCH4IV ACGT 6 cut(s) 339, 505, 543, 626, 700, 762
HpyF10VI GCNNNNNNNGC 3 cut(s) 316, 655, 994
HpyF3I CTNAG 2 cut(s) 131, 378
HpySE526I ACGT 6 cut(s) 339, 505, 543, 626, 700, 762
HspAI GCGC 2 cut(s) 179, 658
Kzo9I GATC 1 cut(s) 78
LmnI GCTCC 2 cut(s) 496, 1444
Lsp1109I GCAGC 1 cut(s) 25
LweI GCATC 2 cut(s) 1020, 1224
MaeI CTAG 1 cut(s) 668
MaeII ACGT 6 cut(s) 339, 505, 543, 626, 700, 762
MaeIII GTNAC 3 cut(s) 622, 1105, 1309
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 8 cut(s) 16, 149, 246, 291, 615, 701, 1036, 1240
MhlI GDGCHC 2 cut(s) 848, 990
MluCI AATT 7 cut(s) 193, 215, 334, 583, 1016, 1220, 1454
MlyI GAGTC 5 cut(s) 615, 728, 764, 1102, 1306
MmeI TCCRAC 2 cut(s) 581, 717
Mph1103I ATGCAT 1 cut(s) 363
MseI TTAA 2 cut(s) 264, 513
MspA1I CMGCKG 1 cut(s) 946
MspI CCGG 5 cut(s) 564, 578, 807, 1039, 1243
MspR9I CCNGG 1 cut(s) 807
MwoI GCNNNNNNNGC 3 cut(s) 316, 655, 994
NciI CCSGG 1 cut(s) 807
NdeI CATATG 2 cut(s) 1175, 1379
NdeII GATC 1 cut(s) 78
NlaIV GGNNCC 5 cut(s) 348, 405, 492, 1074, 1278
NmeAIII GCCGAG 1 cut(s) 845
NmuCI GTSAC 3 cut(s) 622, 1105, 1309
NsiI ATGCAT 1 cut(s) 363
NspI RCATGY 2 cut(s) 1149, 1353
PagI TCATGA 2 cut(s) 1111, 1315
PceI AGGCCT 1 cut(s) 794
PciI ACATGT 2 cut(s) 1145, 1349
PfeI GAWTC 4 cut(s) 123, 200, 230, 374
PkrI GCNGC 3 cut(s) 15, 309, 662
PleI GAGTC 5 cut(s) 614, 727, 764, 1102, 1306
PpsI GAGTC 5 cut(s) 614, 727, 764, 1102, 1306
Ppu21I YACGTR 1 cut(s) 340
PscI ACATGT 2 cut(s) 1145, 1349
Psp1406I AACGTT 2 cut(s) 505, 700
PspN4I GGNNCC 5 cut(s) 348, 405, 492, 1074, 1278
PspPI GGNCC 5 cut(s) 809, 817, 898, 1073, 1277
RsaI GTAC 3 cut(s) 959, 1154, 1358
RsaNI GTAC 3 cut(s) 958, 1153, 1357
SaqAI TTAA 2 cut(s) 264, 513
SatI GCNGC 3 cut(s) 14, 308, 661
Sau3AI GATC 1 cut(s) 78
Sau96I GGNCC 5 cut(s) 809, 817, 898, 1073, 1277
ScaI AGTACT 1 cut(s) 959
SchI GAGTC 5 cut(s) 615, 728, 764, 1102, 1306
ScrFI CCNGG 1 cut(s) 807
SduI GDGCHC 2 cut(s) 848, 990
SfaNI GCATC 2 cut(s) 1020, 1224
SfcI CTRYAG 1 cut(s) 225
SinI GGWCC 2 cut(s) 809, 898
SmlI CTYRAG 3 cut(s) 860, 1120, 1324
SmoI CTYRAG 3 cut(s) 860, 1120, 1324
SnaBI TACGTA 1 cut(s) 340
Sse9I AATT 7 cut(s) 193, 215, 334, 583, 1016, 1220, 1454
SseBI AGGCCT 1 cut(s) 794
SsiI CCGC 7 cut(s) 305, 308, 317, 661, 871, 901, 944
SspMI CTAG 1 cut(s) 668
StuI AGGCCT 1 cut(s) 794
StyD4I CCNGG 1 cut(s) 805
StyI CCWWGG 1 cut(s) 118
TaaI ACNGT 2 cut(s) 751, 936
TaiI ACGT 6 cut(s) 342, 508, 546, 629, 703, 765
TasI AATT 7 cut(s) 193, 215, 334, 583, 1016, 1220, 1454
TatI WGTACW 3 cut(s) 957, 1152, 1356
TauI GCSGC 2 cut(s) 310, 663
TfiI GAWTC 4 cut(s) 123, 200, 230, 374
Tru1I TTAA 2 cut(s) 264, 513
Tru9I TTAA 2 cut(s) 264, 513
TscAI CASTG 5 cut(s) 175, 684, 819, 890, 918
TseFI GTSAC 3 cut(s) 622, 1105, 1309
TseI GCWGC 1 cut(s) 13
Tsp45I GTSAC 3 cut(s) 622, 1105, 1309
TspDTI ATGAA 7 cut(s) 17, 285, 448, 537, 694, 1189, 1393
TspGWI ACGGA 4 cut(s) 1071, 1115, 1275, 1319
TspRI CASTG 5 cut(s) 175, 684, 819, 890, 918
VpaK11BI GGWCC 2 cut(s) 809, 898
XapI RAATTY 3 cut(s) 583, 1016, 1220
XceI RCATGY 2 cut(s) 1149, 1353
XcmI CCANNNNNNNNNTGG 5 cut(s) 364, 448, 478, 679, 784
XspI CTAG 1 cut(s) 668
ZrmI AGTACT 1 cut(s) 959
Zsp2I ATGCAT 1 cut(s) 363
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.