Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002224.1

Orthogroup ID

OG0009286

Physical Location & Seq

Genomic Coordinates Forward (+)

13174 .. 15366

Gene Structure 2193 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002224.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2193 bp

atggtctttcgtgttcacaaatgctttaaaaggctccgcttcctacccactacttcaaactcttctgcattattccatacctcctttcaaagtttttcatctgctttgtcttctccactggggtcgtcgcagcgattggaagaccctacaagactatcagaccttgacattatcatatctagagttcctgttggaagtactgatgatcaagtacttttgtctctttcacatgatcaagcatgtaatagcattcagctcacacatgtccttgttcatcaattgttccatcgatttaagaatgattggaagtcggcactgggtgtgtttagatgggccgagtcacgacctggctataaactccccccagatgcgtatgatatgatcatcgacgttttaggtaaaatgaggcagatggatcagaccatgcatttgttagaaagaatgcatcaggatcgtctggtaacactcaacactgtaggtaaggttatgagaagattcgctggtgcggggaaatgggaggatgctgtgaggatatttgatgggttaggaagatttggattagacaagaacactgaatcaatgaacttgttgcttgacacactctgcaaagagaacaaagttgaggtcgcccgcgatatctttttagaactaaaatcacacatctccccaaatgctcatacgtttaacattttcattcacggctgctttaaaaggctccgcttcctacccactacttcaaactcttctgcattattccatacctcctttcaaagtttttcatctgctttgtcttctccactggggtcgtcgcagcgattggaagaccctacaagactatcagaccttgacattatcatatctagagttcctgttggaagtactgatgatcaagtacttttgtctctttcacatgatcaagcatgtaatagcattcagctcacatatctccttgttcatcagttgttccatcgatttaagaatgattggaagtcggcactgggtgtgtttagatgggccgagtcacgacctggctataaactccccccagatgcgtatgatatgatcatcgacgttttaggtaaaatgaggcagatggatcagaccatgcatttgttagaaagaatgcatcaggatcgtctggtaacactcaacactgtaggtaaggttatgagaagattcgctggtgcggggaaatgggaggatgctgtgaggatatttgatgggttaggaagatttggattagacaagaacactgaatcaatgaacttgttgcttgacacactctgcaaagagaacaaagttgaggtcgcccgcgatatctttttagaactaaaatcacacatctccccaaatgctcatacgtttaacattttcattcacggctggtgcaaggtcaatcgggttgatgaggcacactggacaatccaagaaatgaagggtcatggctgtcgcccctgtgccattagctactcaaccattatcctcttttattgccacaagtacaactttggtaaggtctatgaactgtttgatgaaatggaagctcaaggctgccctccaaatgtagtcactttcaccactgttatgtgttatcttgcaaagtctgaggaattcgaggaagctatgcaattatatgagagaatgaaatcagctggatgtaaacctgataccctgttctacaactcactgatccacacactaggaagagctggacgaatacgtgaagctattcatgtttttgaggttgagatgcctgagaatgaggttcctcacaatacatcaacttacaatacgatgattgccatgttttgcaataatgctcaggaggaggaagccttgaaaatcctccggaagatggaaagttcagggctctgtaagcctgatgttcagacatactatccgttgcttaaaatgtgcttcaaaactggcaaaacagacaattgtttgaatgagttagtgaatgacatggtcaatggacatcatctcagtcttgatctctcaacatatacacttctaattcacggtctatgcagagcaggtaaatgtgagtgggcttacagtctgttcaaagagatgattgctcaagagatgaagcctagatataagacatgtcgtttgctttgggatgaagtcaaactgaagaatatgtctgcagctgctgacagcattgcagatttcatgaagaagctgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_1 PPR_2 PPR_3

Protein Analysis

730

Amino Acids

83.64

Weight (kDa)

7.99

Isoelectric Point (pI)

37.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009286)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G04130 AT3G04130
fragaria_vesca	FvH4_4g36630 FvH4_5g29890 FvH4_5g29890
malus_domestica	MD17G1227800.v1.1 MD17G1228100.v1.1
prunus_persica	Prupe.3G105000_v2.0.a1 Prupe.3G105000_v2.0.a1
pyrus_communis	pycom17g23070
rosa_chinensis	RchiOBHm_Chr7g0223501
rosa_laevigata	RLG00000001960
rosa_multiflora	Rmu_sc0002224.1_g000003
rosa_roxburghii	Rroxscaffold_3G00235660
rosa_rugosa	Rorug07G0217700 Rorug07G0217700 Rorug07G0217700
rosa_samantha	Rh7AG361100 Rh7BG351600 Rh7CG379600 Rh7DG356400
rosa_wichuraiana	Rw7G030690

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	2027
AccII	CGCG	2 cut(s)	633, 1314
AccIII	TCCGGA	1 cut(s)	1848
AciI	CCGC	6 cut(s)	37, 506, 631, 718, 1187, 1312
AclWI	GGATC	5 cut(s)	423, 459, 1104, 1140, 1684
AcsI	RAATTY	1 cut(s)	1610
AcuI	CTGAAG	1 cut(s)	2159
AdeI	CACNNNGTG	2 cut(s)	320, 1001
AfaI	GTAC	5 cut(s)	199, 213, 880, 894, 1502
AfiI	CCNNNNNNNGG	1 cut(s)	1855
AflIII	ACRYGT	2 cut(s)	262, 2108
AgsI	TTSAA	8 cut(s)	57, 89, 738, 770, 1840, 1921, 1948, 2068
AjnI	CCWGG	2 cut(s)	346, 1027
Alw26I	GTCTC	2 cut(s)	225, 906
AlwI	GGATC	5 cut(s)	423, 459, 1104, 1140, 1684
AlwNI	CAGNNNCTG	1 cut(s)	2159
Aor13HI	TCCGGA	1 cut(s)	1848
AoxI	GGCC	2 cut(s)	333, 1014
ApeKI	GCWGC	6 cut(s)	130, 702, 811, 1551, 2153, 2156
ApoI	RAATTY	1 cut(s)	1610
Asp700I	GAANNNNTTC	1 cut(s)	1728
AspS9I	GGNCC	2 cut(s)	333, 1014
AsuHPI	GGTGA	1 cut(s)	1567
BanII	GRGCYC	1 cut(s)	1872
BbsI	GAAGAC	4 cut(s)	102, 147, 783, 828
BbvI	GCAGC	6 cut(s)	142, 689, 823, 1538, 2143, 2165
BccI	CCATC	9 cut(s)	294, 324, 406, 533, 975, 1005, 1087, 1214, 1849
BceAI	ACGGC	2 cut(s)	715, 1396
BcgI	CGANNNNNNTGC	4 cut(s)	434, 468, 1115, 1149
BciT130I	CCWGG	2 cut(s)	348, 1029
BclI	TGATCA	6 cut(s)	205, 232, 381, 886, 913, 1062
BcoDI	GTCTC	2 cut(s)	225, 906
BfaI	CTAG	4 cut(s)	180, 861, 1700, 2097
BfmI	CTRYAG	3 cut(s)	474, 1155, 2151
BfuAI	ACCTGC	1 cut(s)	2027
BisI	GCNGC	6 cut(s)	131, 703, 812, 1552, 2154, 2157
BlsI	GCNGC	6 cut(s)	132, 704, 813, 1553, 2155, 2158
BmcAI	AGTACT	4 cut(s)	199, 213, 880, 894
Bme1390I	CCNGG	2 cut(s)	348, 1029
BmgT120I	GGNCC	2 cut(s)	333, 1014
BmiI	GGNNCC	3 cut(s)	35, 716, 1767
BmrFI	CCNGG	2 cut(s)	348, 1029
BmrI	ACTGGG	4 cut(s)	128, 326, 809, 1007
BmsI	GCATC	7 cut(s)	358, 454, 511, 1039, 1135, 1192, 1740
BmuI	ACTGGG	4 cut(s)	128, 326, 809, 1007
BpiI	GAAGAC	4 cut(s)	102, 147, 783, 828
Bpu10I	CCTNAGC	1 cut(s)	1821
BpuEI	CTTGAG	2 cut(s)	1530, 2067
Bsa29I	ATCGAT	2 cut(s)	289, 970
BsaAI	YACGTR	1 cut(s)	1721
BsaWI	WCCGGW	1 cut(s)	1848
Bsc4I	CCNNNNNNNGG	1 cut(s)	1855
Bse1I	ACTGG	6 cut(s)	123, 321, 804, 1002, 1421, 1930
Bse3DI	GCAATG	1 cut(s)	2166
BseAI	TCCGGA	1 cut(s)	1848
BseBI	CCWGG	2 cut(s)	348, 1029
BseCI	ATCGAT	2 cut(s)	289, 970
BseGI	GGATG	4 cut(s)	526, 1207, 1661, 2131
BseLI	CCNNNNNNNGG	1 cut(s)	1855
BseMI	GCAATG	1 cut(s)	2166
BseMII	CTCAG	4 cut(s)	1596, 1746, 1835, 1999
BseNI	ACTGG	6 cut(s)	123, 321, 804, 1002, 1421, 1930
BseRI	GAGGAG	1 cut(s)	1841
BseXI	GCAGC	6 cut(s)	142, 689, 823, 1538, 2143, 2165
Bsh1236I	CGCG	2 cut(s)	633, 1314
BshFI	GGCC	2 cut(s)	335, 1016
BshVI	ATCGAT	2 cut(s)	289, 970
BsiSI	CCGG	1 cut(s)	1849
BslI	CCNNNNNNNGG	1 cut(s)	1855
BsmAI	GTCTC	2 cut(s)	225, 906
BsmI	GAATGC	4 cut(s)	249, 447, 930, 1128
BsnI	GGCC	2 cut(s)	335, 1016
Bsp1286I	GDGCHC	1 cut(s)	1872
Bsp13I	TCCGGA	1 cut(s)	1848
BspACI	CCGC	6 cut(s)	37, 506, 631, 718, 1187, 1312
BspANI	GGCC	2 cut(s)	335, 1016
BspCNI	CTCAG	4 cut(s)	1597, 1747, 1834, 1998
BspDI	ATCGAT	2 cut(s)	289, 970
BspEI	TCCGGA	1 cut(s)	1848
BspFNI	CGCG	2 cut(s)	633, 1314
BspHI	TCATGA	1 cut(s)	2178
BspLI	GGNNCC	3 cut(s)	35, 716, 1767
BspMAI	CTGCAG	1 cut(s)	2155
BspMI	ACCTGC	1 cut(s)	2027
BspPI	GGATC	5 cut(s)	423, 459, 1104, 1140, 1684
BspQI	GCTCTTC	1 cut(s)	1699
BsrDI	GCAATG	1 cut(s)	2166
BsrI	ACTGG	6 cut(s)	123, 321, 804, 1002, 1421, 1930
Bst2UI	CCWGG	2 cut(s)	348, 1029
Bst4CI	ACNGT	6 cut(s)	475, 1156, 1527, 1582, 2024, 2060
Bst6I	CTCTTC	3 cut(s)	67, 748, 1699
BstBAI	YACGTR	1 cut(s)	1721
BstC8I	GCNNGC	2 cut(s)	631, 1312
BstDEI	CTNAG	4 cut(s)	1605, 1755, 1821, 1985
BstF5I	GGATG	4 cut(s)	526, 1207, 1661, 2131
BstFNI	CGCG	2 cut(s)	633, 1314
BstMAI	GTCTC	2 cut(s)	225, 906
BstMWI	GCNNNNNNNGC	1 cut(s)	1876
BstNI	CCWGG	2 cut(s)	348, 1029
BstNSI	RCATGY	4 cut(s)	243, 266, 924, 2112
BstSCI	CCNGG	2 cut(s)	346, 1027
BstSFI	CTRYAG	3 cut(s)	474, 1155, 2151
BstUI	CGCG	2 cut(s)	633, 1314
BstV1I	GCAGC	6 cut(s)	142, 689, 823, 1538, 2143, 2165
BstV2I	GAAGAC	4 cut(s)	102, 147, 783, 828
Bsu15I	ATCGAT	2 cut(s)	289, 970
BsuRI	GGCC	2 cut(s)	335, 1016
BsuTUI	ATCGAT	2 cut(s)	289, 970
BtsCI	GGATG	4 cut(s)	526, 1207, 1661, 2131
BveI	ACCTGC	1 cut(s)	2027
Cac8I	GCNNGC	2 cut(s)	631, 1312
CaiI	CAGNNNCTG	1 cut(s)	2159
CciI	TCATGA	1 cut(s)	2178
Cfr13I	GGNCC	2 cut(s)	333, 1014
ClaI	ATCGAT	2 cut(s)	289, 970
Csp6I	GTAC	5 cut(s)	198, 212, 879, 893, 1501
CviQI	GTAC	5 cut(s)	198, 212, 879, 893, 1501
DdeI	CTNAG	4 cut(s)	1605, 1755, 1821, 1985
DraI	TTTAAA	2 cut(s)	28, 709
DraIII	CACNNNGTG	2 cut(s)	320, 1001
Eam1104I	CTCTTC	3 cut(s)	67, 748, 1699
EarI	CTCTTC	3 cut(s)	67, 748, 1699
Eco24I	GRGCYC	1 cut(s)	1872
Eco32I	GATATC	2 cut(s)	637, 1318
Eco57I	CTGAAG	1 cut(s)	2159
EcoRI	GAATTC	1 cut(s)	1610
EcoRII	CCWGG	2 cut(s)	346, 1027
EcoRV	GATATC	2 cut(s)	637, 1318
EcoT22I	ATGCAT	4 cut(s)	429, 447, 1110, 1128
EcoT38I	GRGCYC	1 cut(s)	1872
FalI	AAGNNNNNCTT	2 cut(s)	1490, 1522
FauI	CCCGC	4 cut(s)	499, 638, 1180, 1319
FbaI	TGATCA	6 cut(s)	205, 232, 381, 886, 913, 1062
Fnu4HI	GCNGC	6 cut(s)	131, 703, 812, 1552, 2154, 2157
FokI	GGATG	4 cut(s)	533, 1214, 1668, 2138
FriOI	GRGCYC	1 cut(s)	1872
Fsp4HI	GCNGC	6 cut(s)	131, 703, 812, 1552, 2154, 2157
FspBI	CTAG	4 cut(s)	180, 861, 1700, 2097
GluI	GCNGC	6 cut(s)	131, 703, 812, 1552, 2154, 2157
HaeIII	GGCC	2 cut(s)	335, 1016
HapII	CCGG	1 cut(s)	1849
HinfI	GANTC	6 cut(s)	338, 495, 575, 1019, 1176, 1256
HpaII	CCGG	1 cut(s)	1849
HphI	GGTGA	1 cut(s)	1567
Hpy166II	GTNNAC	2 cut(s)	16, 1661
Hpy188I	TCNGA	6 cut(s)	160, 420, 841, 1101, 1606, 1890
Hpy8I	GTNNAC	2 cut(s)	16, 1661
Hpy99I	CGWCG	4 cut(s)	130, 392, 811, 1073
HpyAV	CCTTC	1 cut(s)	1429
HpyCH4III	ACNGT	6 cut(s)	475, 1156, 1527, 1582, 2024, 2060
HpyCH4IV	ACGT	5 cut(s)	390, 680, 1071, 1361, 1720
HpyF10VI	GCNNNNNNNGC	1 cut(s)	1876
HpyF3I	CTNAG	4 cut(s)	1605, 1755, 1821, 1985
HpySE526I	ACGT	5 cut(s)	390, 680, 1071, 1361, 1720
Kpn2I	TCCGGA	1 cut(s)	1848
Ksp22I	TGATCA	6 cut(s)	205, 232, 381, 886, 913, 1062
LguI	GCTCTTC	1 cut(s)	1699
LmnI	GCTCC	2 cut(s)	39, 720
Lsp1109I	GCAGC	6 cut(s)	142, 689, 823, 1538, 2143, 2165
LweI	GCATC	7 cut(s)	358, 454, 511, 1039, 1135, 1192, 1740
MaeI	CTAG	4 cut(s)	180, 861, 1700, 2097
MaeII	ACGT	5 cut(s)	390, 680, 1071, 1361, 1720
MaeIII	GTNAC	5 cut(s)	339, 460, 1020, 1141, 1567
MfeI	CAATTG	2 cut(s)	278, 1939
MhlI	GDGCHC	1 cut(s)	1872
MluCI	AATT	5 cut(s)	278, 1610, 1628, 1939, 2016
MlyI	GAGTC	2 cut(s)	347, 1028
MmeI	TCCRAC	2 cut(s)	172, 853
Mph1103I	ATGCAT	4 cut(s)	429, 447, 1110, 1128
MroI	TCCGGA	1 cut(s)	1848
MroXI	GAANNNNTTC	1 cut(s)	1728
MseI	TTAA	7 cut(s)	27, 294, 684, 708, 975, 1365, 1908
MslI	CAYNNNNRTG	1 cut(s)	1583
MspA1I	CMGCKG	2 cut(s)	1652, 2156
MspI	CCGG	1 cut(s)	1849
MspR9I	CCNGG	2 cut(s)	348, 1029
MunI	CAATTG	2 cut(s)	278, 1939
Mva1269I	GAATGC	4 cut(s)	249, 447, 930, 1128
MvaI	CCWGG	2 cut(s)	348, 1029
MvnI	CGCG	2 cut(s)	633, 1314
MwoI	GCNNNNNNNGC	1 cut(s)	1876
NlaIV	GGNNCC	3 cut(s)	35, 716, 1767
NmeAIII	GCCGAG	2 cut(s)	361, 1042
NmuCI	GTSAC	3 cut(s)	339, 1020, 1567
NsiI	ATGCAT	4 cut(s)	429, 447, 1110, 1128
NspI	RCATGY	4 cut(s)	243, 266, 924, 2112
PagI	TCATGA	1 cut(s)	2178
PciI	ACATGT	2 cut(s)	262, 2108
PciSI	GCTCTTC	1 cut(s)	1699
PctI	GAATGC	4 cut(s)	249, 447, 930, 1128
PdmI	GAANNNNTTC	1 cut(s)	1728
PfeI	GAWTC	4 cut(s)	495, 575, 1176, 1256
PflFI	GACNNNGTC	1 cut(s)	1967
PkrI	GCNGC	6 cut(s)	132, 704, 813, 1553, 2155, 2158
PleI	GAGTC	2 cut(s)	346, 1027
PpsI	GAGTC	2 cut(s)	346, 1027
Ppu21I	YACGTR	1 cut(s)	1721
PscI	ACATGT	2 cut(s)	262, 2108
Psp6I	CCWGG	2 cut(s)	346, 1027
PspGI	CCWGG	2 cut(s)	346, 1027
PspN4I	GGNNCC	3 cut(s)	35, 716, 1767
PspPI	GGNCC	2 cut(s)	333, 1014
PstI	CTGCAG	1 cut(s)	2155
PstNI	CAGNNNCTG	1 cut(s)	2159
PsyI	GACNNNGTC	1 cut(s)	1967
PvuII	CAGCTG	2 cut(s)	1652, 2156
RsaI	GTAC	5 cut(s)	199, 213, 880, 894, 1502
RsaNI	GTAC	5 cut(s)	198, 212, 879, 893, 1501
RseI	CAYNNNNRTG	1 cut(s)	1583
SapI	GCTCTTC	1 cut(s)	1699
SaqAI	TTAA	7 cut(s)	27, 294, 684, 708, 975, 1365, 1908
SatI	GCNGC	6 cut(s)	131, 703, 812, 1552, 2154, 2157
Sau96I	GGNCC	2 cut(s)	333, 1014
ScaI	AGTACT	4 cut(s)	199, 213, 880, 894
SchI	GAGTC	2 cut(s)	347, 1028
ScrFI	CCNGG	2 cut(s)	348, 1029
SduI	GDGCHC	1 cut(s)	1872
SfaNI	GCATC	7 cut(s)	358, 454, 511, 1039, 1135, 1192, 1740
SfcI	CTRYAG	3 cut(s)	474, 1155, 2151
SmiMI	CAYNNNNRTG	1 cut(s)	1583
SmlI	CTYRAG	2 cut(s)	1545, 2082
SmoI	CTYRAG	2 cut(s)	1545, 2082
Sse9I	AATT	5 cut(s)	278, 1610, 1628, 1939, 2016
SsiI	CCGC	6 cut(s)	37, 506, 631, 718, 1187, 1312
SspMI	CTAG	4 cut(s)	180, 861, 1700, 2097
StyD4I	CCNGG	2 cut(s)	346, 1027
TaaI	ACNGT	6 cut(s)	475, 1156, 1527, 1582, 2024, 2060
TaiI	ACGT	5 cut(s)	393, 683, 1074, 1364, 1723
TaqI	TCGA	5 cut(s)	289, 387, 970, 1068, 1614
TasI	AATT	5 cut(s)	278, 1610, 1628, 1939, 2016
TatI	WGTACW	5 cut(s)	197, 211, 878, 892, 1500
TfiI	GAWTC	4 cut(s)	495, 575, 1176, 1256
Tru1I	TTAA	7 cut(s)	27, 294, 684, 708, 975, 1365, 1908
Tru9I	TTAA	7 cut(s)	27, 294, 684, 708, 975, 1365, 1908
TseFI	GTSAC	3 cut(s)	339, 1020, 1567
TseI	GCWGC	6 cut(s)	130, 702, 811, 1551, 2153, 2156
Tsp45I	GTSAC	3 cut(s)	339, 1020, 1567
TspGWI	ACGGA	1 cut(s)	1890
Tth111I	GACNNNGTC	1 cut(s)	1967
XapI	RAATTY	1 cut(s)	1610
XbaI	TCTAGA	2 cut(s)	179, 860
XceI	RCATGY	4 cut(s)	243, 266, 924, 2112
XmnI	GAANNNNTTC	1 cut(s)	1728
XspI	CTAG	4 cut(s)	180, 861, 1700, 2097
ZrmI	AGTACT	4 cut(s)	199, 213, 880, 894
Zsp2I	ATGCAT	4 cut(s)	429, 447, 1110, 1128

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.