Rmu_sc0002547.1_g000015

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002547.1
Physical Location & Seq
Forward (+)
58114 .. 65347
7234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002547.1_g000015.1.cds

Sequence Viewer

Length: 2685 bp
atggtctcaagacagacggcagctttggctctgcgagtcgtcaccgaagcgttcaagatgaggaagcgagatttggccattctcatgctctccgcttttgctatcttcttctctcttcagcacgagggcgacttctccttcagagaggcatggatgcacctcaccgatgactaccccatcaagtacgaagccgaccgcctccccccgccgatcgtcgccgatctcaacggcgacggcaagaaagaagtcctcgtcgccacacacgacgccaaaatccagattctggagcctcatagtaggcgtgtggatgagggattcagtagtgctcgtgttcttgctgaggtcagccttttgccggataaaatccgaatttcctccggcaggcgtgcggtggcgatggccaccggagttatagagaaagtgaggccagggcagagagccaggcaggttttggtggttgttacgtcgggctggtctgtaatgtgcttcgattctaatctcaaaaggctgtgggatgttaatttgcaggaggattttccgcataatgctcaccatagggagattgccatttcgataaccaattacactctgaagcatggggattctggattggtgattgttggcggaaggatggaaatgcagcctcatatttccttagatccttttgaagaaattgggatggcagagaaaagtgctgaccagcatagaagaaatcttactgaaaaggaggcatctgaaaattcaggaactgtggatttacgccattttgcactatatgcttttgccggtggttctggcaaaattagatggactagaaagaatgagaatattgaagcacattcttcagatgcatcacagttgattccgcagcacaactacaaacttgatgttcaggctttgaacagtcgtcatccaggagaatttgcatgtagggaattcagagaatcaatcctcggagttatgccacatcattgggatagaagagaagatactttgttgaaacttgcacacttccggaggcacaaaaggaaaacattgaagaaaacagctggaaagagtatcaactaccctttccataagcctgaagaaaatcatcctcctggaaaggactcgacaaaaaagatttcaaacataattggaaaagctgcccagtacgctggttcagcaaaatccaagaagccacatccatacatccctaccatcacaaatcacactcaactctggtgggtccctaatgtggttgtggctcatcaaaaagaaggaatagaagctgttcacttagcatctggtcgcactctttgcaagcttaatcttcaagaagctggtcttcatgcagatgtaaatggtgatggagtcctagatcatgtccaggctgttggtggaaatggcgctgagcagactgttgttagtggatccatggaagtgctacgtccttgttgggctgttgcaacctctggtgtacctgtgcgagagcaactatttaatgcttctatatgtcatcattcagtttttaacttattccaacatggagattattctagaagctatggtcgagctcctgatttggcttcattggaagtagcaacgcctattctcatcccaagaaatgatggccataggcaccgcaagggaagccatggtgatgttgtctttttgacaaatcgtggtgaggtaacatcctactcacctggcttgcacgggcacggtgctgtttggaattggcatctgttaacgggtgctacatggtcaaatcttccatctccagcggggatgatggaagctgctgtggtggtccctacactgaaggcattctccttgcgtgtccatgacaatcaggaagtgatccttgcagctggagagcaagaggctatcttgatatcacctggaggaagtattttaacctcccttgagcttccagcaccacctacccatgccctgattgctgaggacttctcaaacgacgggctcactgaccttattctcgtgacctcaactggggtgtatggttttgttcagaccaggcaaccaggggccctcttcttcagcatactagtaggtgtcctcatacttgtgatgggagtcatatttgtcacccaacacctgaactccataaagggcaaacctcgtccatctggtcgtgtactttcgatctggaaggatggctttgcctccttctatggtccaaactgtggtggtgaagacgggctcctccgtcaaaatctgcctaaatctctctctcaagcttctgatggcagcagtgatggtgatctggtgtttgatcggctctacagaggtgtgctcgtgggggaaacgaatggcggcacttggtgtctacagcaatcctggactgtagcatctggattgctttggggagctgatggatctgctcggatatggaatttggactacaagaggctgagttttctggctaatggtagcgctctctggcatggctgggatcgctcgtttatgttggaggacaatgggatcggtggtgctctcgattcttctttgctggcagaggtggatgacgggccggcattgggcttcaagtatggtggtggggttcgttatcttctgctagaatgggatccgtttctattcgggtttcttgctggtatgggtggtggtcttcaggaggatgctatcagtgatggtggttatgccggtgtcaaactccggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

894

Amino Acids

98.09

Weight (kDa)

6.99

Isoelectric Point (pI)

39.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011838)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 436
AccB1I GGYRCC 1 cut(s) 1620
AccB7I CCANNNNNTGG 2 cut(s) 283, 2189
AccI GTMKAC 1 cut(s) 2332
AccIII TCCGGA 1 cut(s) 1014
AclWI GGATC 9 cut(s) 653, 1407, 1420, 1837, 2389, 2466, 2495, 2585, 2598
AcoI YGGCCR 3 cut(s) 75, 399, 1612
AcsI RAATTY 5 cut(s) 369, 739, 920, 935, 2398
AcuI CTGAAG 8 cut(s) 101, 124, 611, 828, 1104, 1823, 2026, 2618
AcyI GRCGYC 1 cut(s) 267
AdeI CACNNNGTG 1 cut(s) 2328
AfaI GTAC 4 cut(s) 185, 1154, 1461, 2142
AfeI AGCGCT 1 cut(s) 2440
AfiI CCNNNNNNNGG 7 cut(s) 283, 355, 381, 1237, 1995, 2189, 2543
AgsI TTSAA 9 cut(s) 55, 668, 833, 901, 1000, 1039, 1128, 1316, 2551
AhlI ACTAGT 1 cut(s) 2050
AjuI GAANNNNNNNTTGG 2 cut(s) 56, 88
Alw21I GWGCWC 4 cut(s) 328, 1558, 2301, 2500
Alw26I GTCTC 1 cut(s) 10
AlwI GGATC 9 cut(s) 653, 1407, 1420, 1837, 2389, 2466, 2495, 2585, 2598
AlwNI CAGNNNCTG 2 cut(s) 283, 749
Aor13HI TCCGGA 1 cut(s) 1014
Aor51HI AGCGCT 1 cut(s) 2440
AoxI GGCC 6 cut(s) 75, 399, 425, 1612, 2031, 2534
ApaI GGGCCC 1 cut(s) 2035
ApeKI GCWGC 7 cut(s) 20, 640, 868, 1145, 1781, 1850, 2253
ApoI RAATTY 5 cut(s) 369, 739, 920, 935, 2398
ArsI GACNNNNNNTTYG 2 cut(s) 7, 39
Asp700I GAANNNNTTC 2 cut(s) 1272, 1808
AspLEI GCGC 2 cut(s) 1391, 2441
AspS9I GGNCC 6 cut(s) 1228, 1792, 2031, 2032, 2180, 2534
AvaII GGWCC 3 cut(s) 1228, 1792, 2180
BaeGI GKGCMC 2 cut(s) 1704, 2035
BalI TGGCCA 3 cut(s) 77, 401, 1614
BamHI GGATCC 2 cut(s) 1412, 2590
BanI GGYRCC 1 cut(s) 1620
BanII GRGCYC 4 cut(s) 1558, 1968, 2035, 2208
BarI GAAGNNNNNNTAC 4 cut(s) 700, 732, 973, 1005
BauI CACGAG 4 cut(s) 122, 327, 1982, 2300
BbsI GAAGAC 3 cut(s) 1319, 2205, 2624
Bbv12I GWGCWC 4 cut(s) 328, 1558, 2301, 2500
BbvCI CCTCAGC 2 cut(s) 339, 1944
BbvI GCAGC 7 cut(s) 32, 652, 880, 1132, 1768, 1862, 2265
BceAI ACGGC 3 cut(s) 33, 244, 250
BcoDI GTCTC 1 cut(s) 10
BcuI ACTAGT 1 cut(s) 2050
BfaI CTAG 5 cut(s) 813, 1358, 1539, 2051, 2582
BfmI CTRYAG 3 cut(s) 2287, 2333, 2349
BfoI RGCGCY 2 cut(s) 1392, 2442
BfuAI ACCTGC 1 cut(s) 436
BisI GCNGC 8 cut(s) 21, 641, 869, 1146, 1782, 1851, 2254, 2320
BlpI GCTNAGC 1 cut(s) 1392
BlsI GCNGC 8 cut(s) 22, 642, 870, 1147, 1783, 1852, 2255, 2321
Bme18I GGWCC 3 cut(s) 1228, 1792, 2180
BmgT120I GGNCC 6 cut(s) 1228, 1792, 2031, 2032, 2180, 2534
BmrI ACTGGG 2 cut(s) 1144, 2004
BmsI GCATC 8 cut(s) 144, 740, 838, 860, 1292, 1732, 2363, 2632
BmuI ACTGGG 2 cut(s) 1144, 2004
BpiI GAAGAC 3 cut(s) 1319, 2205, 2624
BplI GAGNNNNNCTC 4 cut(s) 1937, 1969, 2283, 2315
BpmI CTGGAG 4 cut(s) 305, 1746, 1875, 1905
Bpu10I CCTNAGC 2 cut(s) 339, 1944
Bpu1102I GCTNAGC 1 cut(s) 1392
BpuEI CTTGAG 2 cut(s) 1928, 2223
BsaBI GATNNNNATC 2 cut(s) 495, 2265
BsaHI GRCGYC 1 cut(s) 267
BsaI GGTCTC 1 cut(s) 10
BsaJI CCNNGG 5 cut(s) 428, 952, 1416, 1636, 2027
BsaWI WCCGGW 3 cut(s) 404, 1014, 2679
BsaXI ACNNNNNCTCC 2 cut(s) 2090, 2120
Bsc4I CCNNNNNNNGG 7 cut(s) 283, 355, 381, 1237, 1995, 2189, 2543
Bse118I RCCGGY 3 cut(s) 785, 2536, 2666
Bse1I ACTGG 2 cut(s) 1150, 1999
Bse8I GATNNNNATC 2 cut(s) 495, 2265
BseAI TCCGGA 1 cut(s) 1014
BseDI CCNNGG 5 cut(s) 428, 952, 1416, 1636, 2027
BseJI GATNNNNATC 2 cut(s) 495, 2265
BseLI CCNNNNNNNGG 7 cut(s) 283, 355, 381, 1237, 1995, 2189, 2543
BseMII CTCAG 4 cut(s) 330, 1383, 1935, 2408
BseNI ACTGG 2 cut(s) 1150, 1999
BseRI GAGGAG 1 cut(s) 2198
BseSI GKGCMC 2 cut(s) 1704, 2035
BseXI GCAGC 7 cut(s) 32, 652, 880, 1132, 1768, 1862, 2265
BseYI CCCAGC 1 cut(s) 2454
Bsh1285I CGRYCG 2 cut(s) 196, 213
BshFI GGCC 6 cut(s) 77, 401, 427, 1614, 2033, 2536
BshNI GGYRCC 1 cut(s) 1620
BsiEI CGRYCG 2 cut(s) 196, 213
BsiHKAI GWGCWC 4 cut(s) 328, 1558, 2301, 2500
BsiSI CCGG 8 cut(s) 356, 378, 405, 786, 1015, 2537, 2667, 2680
BslFI GGGAC 2 cut(s) 1214, 1778
BslI CCNNNNNNNGG 7 cut(s) 283, 355, 381, 1237, 1995, 2189, 2543
BsmAI GTCTC 1 cut(s) 10
BsmFI GGGAC 2 cut(s) 1214, 1778
BsmI GAATGC 1 cut(s) 1808
BsnI GGCC 6 cut(s) 77, 401, 427, 1614, 2033, 2536
Bso31I GGTCTC 1 cut(s) 10
Bsp120I GGGCCC 1 cut(s) 2031
Bsp1286I GDGCHC 8 cut(s) 328, 1558, 1704, 1968, 2035, 2208, 2301, 2500
Bsp13I TCCGGA 1 cut(s) 1014
Bsp1720I GCTNAGC 1 cut(s) 1392
Bsp19I CCATGG 2 cut(s) 1416, 1636
BspANI GGCC 6 cut(s) 77, 401, 427, 1614, 2033, 2536
BspCNI CTCAG 4 cut(s) 331, 1384, 1936, 2409
BspEI TCCGGA 1 cut(s) 1014
BspMI ACCTGC 1 cut(s) 436
BspPI GGATC 9 cut(s) 653, 1407, 1420, 1837, 2389, 2466, 2495, 2585, 2598
BspT107I GGYRCC 1 cut(s) 1620
BspTNI GGTCTC 1 cut(s) 10
BsrFI RCCGGY 3 cut(s) 785, 2536, 2666
BsrI ACTGG 2 cut(s) 1150, 1999
BssAI RCCGGY 3 cut(s) 785, 2536, 2666
BssECI CCNNGG 5 cut(s) 428, 952, 1416, 1636, 2027
BssNI GRCGYC 1 cut(s) 267
BssSI CACGAG 4 cut(s) 122, 327, 1982, 2300
BssT1I CCWWGG 2 cut(s) 1416, 1636
Bst2BI CACGAG 4 cut(s) 122, 327, 1982, 2300
Bst4CI ACNGT 7 cut(s) 751, 858, 905, 1402, 1706, 2189, 2350
Bst6I CTCTTC 3 cut(s) 120, 976, 2042
BstACI GRCGYC 1 cut(s) 267
BstAPI GCANNNNNTGC 2 cut(s) 776, 1299
BstC8I GCNNGC 6 cut(s) 383, 387, 1304, 1694, 2517, 2538
BstDEI CTNAG 6 cut(s) 339, 655, 1279, 1392, 1944, 2417
BstDSI CCRYGG 2 cut(s) 1416, 1636
BstENI CCTNNNNNAGG 1 cut(s) 379
BstH2I RGCGCY 2 cut(s) 1392, 2442
BstHHI GCGC 2 cut(s) 1391, 2441
BstMAI GTCTC 1 cut(s) 10
BstMCI CGRYCG 2 cut(s) 196, 213
BstMWI GCNNNNNNNGC 8 cut(s) 26, 776, 1154, 1163, 1299, 1632, 1940, 2460
BstNSI RCATGY 1 cut(s) 930
BstSFI CTRYAG 3 cut(s) 2287, 2333, 2349
BstSLI GKGCMC 2 cut(s) 1704, 2035
BstV1I GCAGC 7 cut(s) 32, 652, 880, 1132, 1768, 1862, 2265
BstV2I GAAGAC 3 cut(s) 1319, 2205, 2624
BstX2I RGATCY 4 cut(s) 658, 1412, 2381, 2590
BstXI CCANNNNNNTGG 3 cut(s) 972, 1157, 1376
BstYI RGATCY 4 cut(s) 658, 1412, 2381, 2590
BsuRI GGCC 6 cut(s) 77, 401, 427, 1614, 2033, 2536
BtgI CCRYGG 2 cut(s) 1416, 1636
BtgZI GCGATG 1 cut(s) 410
BtsI GCAGTG 1 cut(s) 2263
BtsIMutI CAGTG 4 cut(s) 1799, 1968, 2263, 2656
BveI ACCTGC 1 cut(s) 436
Cac8I GCNNGC 6 cut(s) 383, 387, 1304, 1694, 2517, 2538
CaiI CAGNNNCTG 2 cut(s) 283, 749
CfoI GCGC 2 cut(s) 1391, 2441
Cfr10I RCCGGY 3 cut(s) 785, 2536, 2666
Cfr13I GGNCC 6 cut(s) 1228, 1792, 2031, 2032, 2180, 2534
CseI GACGC 1 cut(s) 275
Csp6I GTAC 4 cut(s) 184, 1153, 1460, 2141
CspCI CAANNNNNGTGG 4 cut(s) 1205, 1240, 2539, 2574
CviQI GTAC 4 cut(s) 184, 1153, 1460, 2141
DdeI CTNAG 6 cut(s) 339, 655, 1279, 1392, 1944, 2417
DraIII CACNNNGTG 1 cut(s) 2328
EaeI YGGCCR 3 cut(s) 75, 399, 1612
Eam1104I CTCTTC 3 cut(s) 120, 976, 2042
EarI CTCTTC 3 cut(s) 120, 976, 2042
EciI GGCGGA 1 cut(s) 639
Ecl136II GAGCTC 1 cut(s) 1556
Eco130I CCWWGG 2 cut(s) 1416, 1636
Eco24I GRGCYC 4 cut(s) 1558, 1968, 2035, 2208
Eco31I GGTCTC 1 cut(s) 10
Eco32I GATATC 1 cut(s) 1878
Eco47I GGWCC 3 cut(s) 1228, 1792, 2180
Eco47III AGCGCT 1 cut(s) 2440
Eco53kI GAGCTC 1 cut(s) 1556
Eco57I CTGAAG 8 cut(s) 101, 124, 611, 828, 1104, 1823, 2026, 2618
EcoICRI GAGCTC 1 cut(s) 1556
EcoNI CCTNNNNNAGG 1 cut(s) 379
EcoO109I RGGNCCY 3 cut(s) 1228, 2031, 2032
EcoRI GAATTC 1 cut(s) 935
EcoRV GATATC 1 cut(s) 1878
EcoT14I CCWWGG 2 cut(s) 1416, 1636
EcoT22I ATGCAT 1 cut(s) 853
EcoT38I GRGCYC 4 cut(s) 1558, 1968, 2035, 2208
ErhI CCWWGG 2 cut(s) 1416, 1636
FalI AAGNNNNNCTT 6 cut(s) 1311, 1343, 1830, 1862, 2147, 2179
FaqI GGGAC 2 cut(s) 1214, 1778
FauI CCCGC 2 cut(s) 213, 1759
FblI GTMKAC 1 cut(s) 2332
Fnu4HI GCNGC 8 cut(s) 21, 641, 869, 1146, 1782, 1851, 2254, 2320
FriOI GRGCYC 4 cut(s) 1558, 1968, 2035, 2208
Fsp4HI GCNGC 8 cut(s) 21, 641, 869, 1146, 1782, 1851, 2254, 2320
FspBI CTAG 5 cut(s) 813, 1358, 1539, 2051, 2582
GlaI GCGC 2 cut(s) 1390, 2440
GluI GCNGC 8 cut(s) 21, 641, 869, 1146, 1782, 1851, 2254, 2320
GsaI CCCAGC 1 cut(s) 2458
GsuI CTGGAG 4 cut(s) 305, 1746, 1875, 1905
HaeII RGCGCY 2 cut(s) 1392, 2442
HaeIII GGCC 6 cut(s) 77, 401, 427, 1614, 2033, 2536
HapII CCGG 8 cut(s) 356, 378, 405, 786, 1015, 2537, 2667, 2680
HgaI GACGC 1 cut(s) 275
HhaI GCGC 2 cut(s) 1391, 2441
Hin1I GRCGYC 1 cut(s) 267
Hin6I GCGC 2 cut(s) 1389, 2439
HinP1I GCGC 2 cut(s) 1389, 2439
HincII GTYRAC 1 cut(s) 1731
HindII GTYRAC 1 cut(s) 1731
HindIII AAGCTT 2 cut(s) 1304, 2241
HpaI GTTAAC 1 cut(s) 1731
HpaII CCGG 8 cut(s) 356, 378, 405, 786, 1015, 2537, 2667, 2680
Hpy166II GTNNAC 5 cut(s) 1276, 1460, 1731, 2141, 2333
Hpy8I GTNNAC 5 cut(s) 1276, 1460, 1731, 2141, 2333
Hpy99I CGWCG 6 cut(s) 218, 236, 257, 269, 469, 1964
HpyAV CCTTC 6 cut(s) 148, 621, 1253, 1798, 2149, 2182
HpyCH4III ACNGT 7 cut(s) 751, 858, 905, 1402, 1706, 2189, 2350
HpyCH4IV ACGT 2 cut(s) 464, 1429
HpyF10VI GCNNNNNNNGC 8 cut(s) 26, 776, 1154, 1163, 1299, 1632, 1940, 2460
HpyF3I CTNAG 6 cut(s) 339, 655, 1279, 1392, 1944, 2417
HpySE526I ACGT 2 cut(s) 464, 1429
Hsp92I GRCGYC 1 cut(s) 267
HspAI GCGC 2 cut(s) 1389, 2439
KflI GGGWCCC 1 cut(s) 1228
Kpn2I TCCGGA 1 cut(s) 1014
KroI GCCGGC 1 cut(s) 2536
KroNI GCCGGC 1 cut(s) 2538
KspAI GTTAAC 1 cut(s) 1731
LmnI GCTCC 4 cut(s) 286, 1561, 2211, 2372
Lsp1109I GCAGC 7 cut(s) 32, 652, 880, 1132, 1768, 1862, 2265
LweI GCATC 8 cut(s) 144, 740, 838, 860, 1292, 1732, 2363, 2632
MaeI CTAG 5 cut(s) 813, 1358, 1539, 2051, 2582
MaeII ACGT 2 cut(s) 464, 1429
MaeIII GTNAC 5 cut(s) 40, 460, 1672, 1984, 2089
MflI RGATCY 4 cut(s) 658, 1412, 2381, 2590
MhlI GDGCHC 8 cut(s) 328, 1558, 1704, 1968, 2035, 2208, 2301, 2500
MlsI TGGCCA 3 cut(s) 77, 401, 1614
MluNI TGGCCA 3 cut(s) 77, 401, 1614
MlyI GAGTC 4 cut(s) 45, 1103, 1362, 2088
MmeI TCCRAC 2 cut(s) 1546, 2454
Mox20I TGGCCA 3 cut(s) 77, 401, 1614
Mph1103I ATGCAT 1 cut(s) 853
MroI TCCGGA 1 cut(s) 1014
MroNI GCCGGC 1 cut(s) 2536
MroXI GAANNNNTTC 2 cut(s) 1272, 1808
MscI TGGCCA 3 cut(s) 77, 401, 1614
MseI TTAA 6 cut(s) 519, 1308, 1482, 1512, 1730, 1898
MslI CAYNNNNRTG 5 cut(s) 83, 1335, 1421, 1641, 2069
Msp20I TGGCCA 3 cut(s) 77, 401, 1614
MspA1I CMGCKG 3 cut(s) 1049, 1766, 1853
MspI CCGG 8 cut(s) 356, 378, 405, 786, 1015, 2537, 2667, 2680
Mva1269I GAATGC 1 cut(s) 1808
MwoI GCNNNNNNNGC 8 cut(s) 26, 776, 1154, 1163, 1299, 1632, 1940, 2460
NaeI GCCGGC 1 cut(s) 2538
NcoI CCATGG 2 cut(s) 1416, 1636
NgoMIV GCCGGC 1 cut(s) 2536
NmuCI GTSAC 3 cut(s) 40, 1984, 2089
NsiI ATGCAT 1 cut(s) 853
NspI RCATGY 1 cut(s) 930
PcsI WCGNNNNNNNCGW 1 cut(s) 261
PctI GAATGC 1 cut(s) 1808
PdiI GCCGGC 1 cut(s) 2538
PdmI GAANNNNTTC 2 cut(s) 1272, 1808
PfeI GAWTC 7 cut(s) 280, 315, 491, 602, 862, 944, 2504
PflMI CCANNNNNTGG 2 cut(s) 283, 2189
PfoI TCCNGGA 3 cut(s) 913, 1099, 2342
PkrI GCNGC 8 cut(s) 22, 642, 870, 1147, 1783, 1852, 2255, 2321
Ple19I CGATCG 1 cut(s) 213
PleI GAGTC 4 cut(s) 44, 1103, 1361, 2087
PpsI GAGTC 4 cut(s) 44, 1103, 1361, 2087
PpuMI RGGWCCY 1 cut(s) 1228
Psp124BI GAGCTC 1 cut(s) 1558
Psp5II RGGWCCY 1 cut(s) 1228
PspFI CCCAGC 1 cut(s) 2454
PspOMI GGGCCC 1 cut(s) 2031
PspPI GGNCC 6 cut(s) 1228, 1792, 2031, 2032, 2180, 2534
PspPPI RGGWCCY 1 cut(s) 1228
PstNI CAGNNNCTG 2 cut(s) 283, 749
PsuI RGATCY 4 cut(s) 658, 1412, 2381, 2590
PvuI CGATCG 1 cut(s) 213
PvuII CAGCTG 2 cut(s) 1049, 1853
RsaI GTAC 4 cut(s) 185, 1154, 1461, 2142
RsaNI GTAC 4 cut(s) 184, 1153, 1460, 2141
RseI CAYNNNNRTG 5 cut(s) 83, 1335, 1421, 1641, 2069
SacI GAGCTC 1 cut(s) 1558
SaqAI TTAA 6 cut(s) 519, 1308, 1482, 1512, 1730, 1898
SatI GCNGC 8 cut(s) 21, 641, 869, 1146, 1782, 1851, 2254, 2320
Sau96I GGNCC 6 cut(s) 1228, 1792, 2031, 2032, 2180, 2534
SchI GAGTC 4 cut(s) 45, 1103, 1362, 2088
SduI GDGCHC 8 cut(s) 328, 1558, 1704, 1968, 2035, 2208, 2301, 2500
SfaNI GCATC 8 cut(s) 144, 740, 838, 860, 1292, 1732, 2363, 2632
SfcI CTRYAG 3 cut(s) 2287, 2333, 2349
SinI GGWCC 3 cut(s) 1228, 1792, 2180
SmiMI CAYNNNNRTG 5 cut(s) 83, 1335, 1421, 1641, 2069
SmlI CTYRAG 3 cut(s) 7, 1907, 2238
SmoI CTYRAG 3 cut(s) 7, 1907, 2238
SpeI ACTAGT 1 cut(s) 2050
SspI AATATT 1 cut(s) 829
SspMI CTAG 5 cut(s) 813, 1358, 1539, 2051, 2582
SstI GAGCTC 1 cut(s) 1558
StyI CCWWGG 2 cut(s) 1416, 1636
TaaI ACNGT 7 cut(s) 751, 858, 905, 1402, 1706, 2189, 2350
TaiI ACGT 2 cut(s) 467, 1432
TaqI TCGA 6 cut(s) 489, 572, 1112, 1552, 2147, 2502
TatI WGTACW 1 cut(s) 2140
TauI GCSGC 1 cut(s) 2322
TfiI GAWTC 7 cut(s) 280, 315, 491, 602, 862, 944, 2504
Tru1I TTAA 6 cut(s) 519, 1308, 1482, 1512, 1730, 1898
Tru9I TTAA 6 cut(s) 519, 1308, 1482, 1512, 1730, 1898
TscAI CASTG 4 cut(s) 1806, 1975, 2263, 2656
TseFI GTSAC 3 cut(s) 40, 1984, 2089
TseI GCWGC 7 cut(s) 20, 640, 868, 1145, 1781, 1850, 2253
Tsp45I GTSAC 3 cut(s) 40, 1984, 2089
TspDTI ATGAA 2 cut(s) 1319, 1560
TspGWI ACGGA 2 cut(s) 2201, 2583
TspRI CASTG 4 cut(s) 1806, 1975, 2263, 2656
Van91I CCANNNNNTGG 2 cut(s) 283, 2189
VpaK11BI GGWCC 3 cut(s) 1228, 1792, 2180
XagI CCTNNNNNAGG 1 cut(s) 379
XapI RAATTY 5 cut(s) 369, 739, 920, 935, 2398
XbaI TCTAGA 1 cut(s) 1538
XceI RCATGY 1 cut(s) 930
XcmI CCANNNNNNNNNTGG 2 cut(s) 448, 1376
XmiI GTMKAC 1 cut(s) 2332
XmnI GAANNNNTTC 2 cut(s) 1272, 1808
XspI CTAG 5 cut(s) 813, 1358, 1539, 2051, 2582
Zsp2I ATGCAT 1 cut(s) 853
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.