Rmu_sc0002598.1_g000012

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002598.1
Physical Location & Seq
Forward (+)
44330 .. 46525
2196 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002598.1_g000012.1.cds

Sequence Viewer

Length: 2196 bp
atgccaacaaaactccaaactacaaccaaccttttccataaacacatcctcaactatagcttcccacgttataaggctcgctgctcatatttgtctactcaagcatactatgactttcaaagcagaaaagctagcagctttcttgtttactgcaactcccaaatcactaaaagtggaagaaatggtgatctcaaacaagcagagtcgattttcaatcgtatgccaactaaggacactatcacctggactgccatgcttactgcatatgcagagaatggccagactagcttggcacgcaaggtgttcgatgaaatgccccaacgaaacgtagcatcatataatgcgatgatcacgggttatattcggagcaaaggtaatgtagatgaagcttttgggttgttttgtacgatgcctgggcgtaatgtggtgtcttatagtgtgatgatcactggtttcgcaaaggcgtggatgttcgacgaggctgagaggctttactgtgagatgccaggtcagtggcgggaaccggtttgttcaaatgcgttgatgaatgggtatttgaaggcgggaagaatcgaagaggcggttagagttttcgagggaatgtcagagagaaatgtggtttctgagagttgcatggttgatgggtattgcaaactgggaaggattgatgatgctagaaatttgtttgatgtgatgctggagaggactgtggttacttggacggcaatgattgatgggtacatgaagaagggaatgttcgaaaggggttttgaattgttttcggatatgagaagggaggggatagtggaggtcaattccactaccatgagcataatgtttgacgcttgtggtgcttttgctagatgtggagaagggattcagatgcacgggttagtttcccgaatgggatttgattatgatgtctttttaggaaattctattatcattatgtattgtaggtttggttttgtagatgaagctactaagataatacgtatgatgagcaagacaaatatagtttcctggaattccttaatcgcaggttatgttcaatgtgccgaagttgaagtagcttttaaactgtttgagatgatgcctgaaaaggatgtagtttcatggacgaccatgatatcaggattctcaagcaagggcatgactaggaaagccatccaattgtttttgttgatgcctgagaaggatgatgttgcttggactgctctagtttcaggttttgtaaataatgaggaatatgaggaggctctccattggtttatcaagatgcttcggaaaacaaccaggcctaatccacttactttgagcagtgtgctcagtgcttcagccagtttggccgctctaaatgaggggatgcagatccattctttttcactgaaggtgaatatggaaaataatttatctgttcgaaatgctctggtctcaatgtattcgaagtgtgggaatgtcattgatgccaatcggatcttcacaagtatcttttcacccaatactgtttcattcaactccatgattactgggtttgcccaaaatggttttggggaagaagccctgaacttgttttggagcatgcagaatgtaggttgcgagccaaaccaaatcacatttctgggtgttctttcagcttgtgtccatgtgggactagttaaagaaggacggcagttttttaattcgatgcaatcattgcaccacatagaaccaggactggatcactatgcttgcatggttgatctccttggacgatctggcttgctagatgaagctgtcgagttgattcattcaatgccgtttgagccccatgctggggtttggggagctcttcttggtgctagcagggctcatttacgtcttgatcttgcagagcttgcaactcagcacctgatcaaattggagcctgataatgcaaccccttatgtggttttatccaatatatattctactttagggaaagtgaaggatggagagcaagtgaggatgaccaagaattcaaaagggataaggaagagtccaggctgcagctgggtcacattgaaggacaaggttcatttatttcttgcaggagatcaatcccatcaggacttccaagatattgaagtgatactctggatcataacaatggaaataggacagctagctggatcgtccaaaggtgatcattctttgaattgttttctgcatcagtaa

Protein Analysis

731

Amino Acids

82.15

Weight (kDa)

6.41

Isoelectric Point (pI)

36.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014592)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G53600 AT1G53600
fragaria_vesca FvH4_3g16920
malus_domestica MD03G1255800.v1.1
prunus_persica Prupe.4G151400_v2.0.a1
pyrus_communis pycom03g20240
rosa_chinensis RchiOBHm_Chr5g0028141
rosa_laevigata RLG00000033071
rosa_multiflora Rmu_co8381305.1_g000001 Rmu_sc0002598.1_g000012
rosa_roxburghii Rroxscaffold_1G00051540
rosa_rugosa Rorug05G0104400
rosa_samantha Rh5AG197600 Rh5BG196200 Rh5CG216200 Rh5DG197900
rosa_wichuraiana Rw5G018060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 72
Acc36I ACCTGC 1 cut(s) 1031
AccBSI CCGCTC 1 cut(s) 1352
AccI GTMKAC 1 cut(s) 95
AciI CCGC 4 cut(s) 517, 563, 581, 1350
AclWI GGATC 5 cut(s) 1366, 1484, 1728, 2126, 2158
AcoI YGGCCR 2 cut(s) 277, 1347
AcsI RAATTY 4 cut(s) 679, 934, 1027, 1996
AcuI CTGAAG 2 cut(s) 1320, 1409
AfaI GTAC 2 cut(s) 406, 740
AfiI CCNNNNNNNGG 4 cut(s) 1814, 1815, 1816, 1927
AgeI ACCGGT 1 cut(s) 523
AhlI ACTAGT 1 cut(s) 1654
AjnI CCWGG 7 cut(s) 242, 412, 505, 1022, 1295, 1711, 2020
AjuI GAANNNNNNNTTGG 4 cut(s) 1463, 1495, 1602, 1634
Alw21I GWGCWC 2 cut(s) 1329, 1831
Alw26I GTCTC 1 cut(s) 1438
AlwI GGATC 5 cut(s) 1366, 1484, 1728, 2126, 2158
AlwNI CAGNNNCTG 1 cut(s) 1891
AoxI GGCC 3 cut(s) 277, 1298, 1347
ApeKI GCWGC 4 cut(s) 81, 135, 2025, 2028
ApoI RAATTY 4 cut(s) 679, 934, 1027, 1996
AsiGI ACCGGT 1 cut(s) 523
Asp700I GAANNNNTTC 1 cut(s) 876
AsuHPI GGTGA 5 cut(s) 197, 232, 1405, 1488, 2174
AsuII TTCGAA 3 cut(s) 759, 1420, 1445
AsuNHI GCTAGC 3 cut(s) 131, 1841, 2143
BalI TGGCCA 1 cut(s) 279
BanII GRGCYC 3 cut(s) 1809, 1831, 1852
Bbv12I GWGCWC 2 cut(s) 1329, 1831
BbvI GCAGC 4 cut(s) 68, 147, 2012, 2040
BccI CCATC 5 cut(s) 635, 728, 1175, 1964, 2091
BceAI ACGGC 3 cut(s) 738, 1685, 1783
BcgI CGANNNNNNTGC 2 cut(s) 286, 320
BciT130I CCWGG 7 cut(s) 244, 414, 507, 1024, 1297, 1713, 2022
BclI TGATCA 4 cut(s) 348, 444, 1893, 2164
BcoDI GTCTC 1 cut(s) 1438
BcuI ACTAGT 1 cut(s) 1654
BfmI CTRYAG 2 cut(s) 55, 2026
BfuAI ACCTGC 1 cut(s) 1031
BglI GCCNNNNNGGC 1 cut(s) 1346
BisI GCNGC 5 cut(s) 82, 136, 1350, 2026, 2029
BlsI GCNGC 5 cut(s) 83, 137, 1351, 2027, 2030
Bme1390I CCNGG 7 cut(s) 244, 414, 507, 1024, 1297, 1713, 2022
BmiI GGNNCC 2 cut(s) 522, 1905
BmrFI CCNGG 7 cut(s) 244, 414, 507, 1024, 1297, 1713, 2022
BmrI ACTGGG 2 cut(s) 665, 1539
BmtI GCTAGC 3 cut(s) 135, 1845, 2147
BmuI ACTGGG 2 cut(s) 665, 1539
BpmI CTGGAG 1 cut(s) 719
Bpu14I TTCGAA 3 cut(s) 759, 1420, 1445
BpuEI CTTGAG 2 cut(s) 84, 1126
BsaAI YACGTR 1 cut(s) 995
BsaBI GATNNNNATC 2 cut(s) 1370, 1470
BsaI GGTCTC 1 cut(s) 1438
BsaJI CCNNGG 2 cut(s) 413, 1747
BsaWI WCCGGW 1 cut(s) 523
BsaXI ACNNNNNCTCC 6 cut(s) 140, 170, 358, 388, 1965, 1995
Bsc4I CCNNNNNNNGG 4 cut(s) 1814, 1815, 1816, 1927
Bse118I RCCGGY 1 cut(s) 523
Bse1I ACTGG 5 cut(s) 454, 660, 1341, 1534, 1722
Bse3DI GCAATG 2 cut(s) 732, 1694
Bse8I GATNNNNATC 2 cut(s) 1370, 1470
BseBI CCWGG 7 cut(s) 244, 414, 507, 1024, 1297, 1713, 2022
BseDI CCNNGG 2 cut(s) 413, 1747
BseGI GGATG 8 cut(s) 45, 474, 1111, 1167, 1204, 1371, 1975, 1992
BseJI GATNNNNATC 2 cut(s) 1370, 1470
BseLI CCNNNNNNNGG 4 cut(s) 1814, 1815, 1816, 1927
BseMI GCAATG 2 cut(s) 732, 1694
BseMII CTCAG 5 cut(s) 474, 615, 1182, 1342, 1898
BseNI ACTGG 5 cut(s) 454, 660, 1341, 1534, 1722
BseRI GAGGAG 1 cut(s) 1268
BseXI GCAGC 4 cut(s) 68, 147, 2012, 2040
BseYI CCCAGC 2 cut(s) 1814, 2031
BshFI GGCC 3 cut(s) 279, 1300, 1349
BshTI ACCGGT 1 cut(s) 523
BsiHKAI GWGCWC 2 cut(s) 1329, 1831
BsiSI CCGG 1 cut(s) 524
BslFI GGGAC 1 cut(s) 1665
BslI CCNNNNNNNGG 4 cut(s) 1814, 1815, 1816, 1927
BsmAI GTCTC 1 cut(s) 1438
BsmFI GGGAC 1 cut(s) 1665
BsnI GGCC 3 cut(s) 279, 1300, 1349
Bso31I GGTCTC 1 cut(s) 1438
Bsp119I TTCGAA 3 cut(s) 759, 1420, 1445
Bsp1286I GDGCHC 4 cut(s) 1329, 1809, 1831, 1852
BspACI CCGC 4 cut(s) 517, 563, 581, 1350
BspANI GGCC 3 cut(s) 279, 1300, 1349
BspCNI CTCAG 5 cut(s) 475, 616, 1183, 1341, 1897
BspLI GGNNCC 2 cut(s) 522, 1905
BspMAI CTGCAG 1 cut(s) 2030
BspMI ACCTGC 1 cut(s) 1031
BspOI GCTAGC 3 cut(s) 135, 1845, 2147
BspPI GGATC 5 cut(s) 1366, 1484, 1728, 2126, 2158
BspQI GCTCTTC 1 cut(s) 1836
BspT104I TTCGAA 3 cut(s) 759, 1420, 1445
BspTNI GGTCTC 1 cut(s) 1438
BsrBI CCGCTC 1 cut(s) 1352
BsrDI GCAATG 2 cut(s) 732, 1694
BsrFI RCCGGY 1 cut(s) 523
BsrI ACTGG 5 cut(s) 454, 660, 1341, 1534, 1722
BssAI RCCGGY 1 cut(s) 523
BssECI CCNNGG 2 cut(s) 413, 1747
BssT1I CCWWGG 1 cut(s) 1747
Bst2UI CCWGG 7 cut(s) 244, 414, 507, 1024, 1297, 1713, 2022
Bst4CI ACNGT 4 cut(s) 497, 709, 1083, 1507
Bst6I CTCTTC 3 cut(s) 570, 1836, 2009
BstAPI GCANNNNNTGC 2 cut(s) 1696, 1877
BstBAI YACGTR 1 cut(s) 995
BstBI TTCGAA 3 cut(s) 759, 1420, 1445
BstDEI CTNAG 7 cut(s) 228, 483, 624, 984, 1191, 1328, 1884
BstF5I GGATG 8 cut(s) 45, 474, 1111, 1167, 1204, 1371, 1975, 1992
BstMAI GTCTC 1 cut(s) 1438
BstMWI GCNNNNNNNGC 9 cut(s) 285, 294, 851, 1214, 1346, 1696, 1804, 1847, 1877
BstNI CCWGG 7 cut(s) 244, 414, 507, 1024, 1297, 1713, 2022
BstNSI RCATGY 1 cut(s) 1585
BstSCI CCNGG 7 cut(s) 242, 412, 505, 1022, 1295, 1711, 2020
BstSFI CTRYAG 2 cut(s) 55, 2026
BstSNI TACGTA 1 cut(s) 995
BstV1I GCAGC 4 cut(s) 68, 147, 2012, 2040
BstX2I RGATCY 2 cut(s) 1371, 1476
BstXI CCANNNNNNTGG 1 cut(s) 513
BstYI RGATCY 2 cut(s) 1371, 1476
BsuRI GGCC 3 cut(s) 279, 1300, 1349
BtgZI GCGATG 1 cut(s) 359
BtsCI GGATG 8 cut(s) 45, 474, 1111, 1167, 1204, 1371, 1975, 1992
BtsI GCAGTG 1 cut(s) 1327
BtsIMutI CAGTG 5 cut(s) 447, 518, 1327, 1336, 1385
BveI ACCTGC 1 cut(s) 1031
CaiI CAGNNNCTG 1 cut(s) 1891
Cfr10I RCCGGY 1 cut(s) 523
CseI GACGC 1 cut(s) 851
Csp6I GTAC 2 cut(s) 405, 739
CspAI ACCGGT 1 cut(s) 523
CspCI CAANNNNNGTGG 2 cut(s) 1296, 1331
CviQI GTAC 2 cut(s) 405, 739
DdeI CTNAG 7 cut(s) 228, 483, 624, 984, 1191, 1328, 1884
DraI TTTAAA 1 cut(s) 1078
EaeI YGGCCR 2 cut(s) 277, 1347
Eam1104I CTCTTC 3 cut(s) 570, 1836, 2009
EarI CTCTTC 3 cut(s) 570, 1836, 2009
Ecl136II GAGCTC 1 cut(s) 1829
Eco105I TACGTA 1 cut(s) 995
Eco130I CCWWGG 1 cut(s) 1747
Eco147I AGGCCT 1 cut(s) 1300
Eco24I GRGCYC 3 cut(s) 1809, 1831, 1852
Eco31I GGTCTC 1 cut(s) 1438
Eco32I GATATC 1 cut(s) 1131
Eco53kI GAGCTC 1 cut(s) 1829
Eco57I CTGAAG 2 cut(s) 1320, 1409
EcoICRI GAGCTC 1 cut(s) 1829
EcoRI GAATTC 2 cut(s) 1027, 1996
EcoRII CCWGG 7 cut(s) 242, 412, 505, 1022, 1295, 1711, 2020
EcoRV GATATC 1 cut(s) 1131
EcoT14I CCWWGG 1 cut(s) 1747
EcoT38I GRGCYC 3 cut(s) 1809, 1831, 1852
ErhI CCWWGG 1 cut(s) 1747
FaqI GGGAC 1 cut(s) 1665
FauI CCCGC 2 cut(s) 510, 556
FauNDI CATATG 1 cut(s) 265
FbaI TGATCA 4 cut(s) 348, 444, 1893, 2164
FblI GTMKAC 1 cut(s) 95
Fnu4HI GCNGC 5 cut(s) 82, 136, 1350, 2026, 2029
FokI GGATG 8 cut(s) 32, 481, 1118, 1154, 1211, 1378, 1982, 1999
FriOI GRGCYC 3 cut(s) 1809, 1831, 1852
Fsp4HI GCNGC 5 cut(s) 82, 136, 1350, 2026, 2029
GluI GCNGC 5 cut(s) 82, 136, 1350, 2026, 2029
GsaI CCCAGC 2 cut(s) 1818, 2035
GsuI CTGGAG 1 cut(s) 719
HaeIII GGCC 3 cut(s) 279, 1300, 1349
HapII CCGG 1 cut(s) 524
HgaI GACGC 1 cut(s) 851
HindIII AAGCTT 1 cut(s) 387
HinfI GANTC 6 cut(s) 203, 570, 877, 1137, 1786, 2017
HpaII CCGG 1 cut(s) 524
HphI GGTGA 5 cut(s) 197, 232, 1405, 1488, 2174
Hpy166II GTNNAC 2 cut(s) 96, 148
Hpy188I TCNGA 7 cut(s) 366, 607, 625, 784, 882, 1287, 1476
Hpy188III TCNNGA 6 cut(s) 900, 1134, 1276, 1862, 2087, 2116
Hpy8I GTNNAC 2 cut(s) 96, 148
Hpy99I CGWCG 1 cut(s) 479
HpyCH4III ACNGT 4 cut(s) 497, 709, 1083, 1507
HpyCH4IV ACGT 4 cut(s) 67, 327, 994, 1858
HpyF10VI GCNNNNNNNGC 9 cut(s) 285, 294, 851, 1214, 1346, 1696, 1804, 1847, 1877
HpyF3I CTNAG 7 cut(s) 228, 483, 624, 984, 1191, 1328, 1884
HpySE526I ACGT 4 cut(s) 67, 327, 994, 1858
Ksp22I TGATCA 4 cut(s) 348, 444, 1893, 2164
LguI GCTCTTC 1 cut(s) 1836
LmnI GCTCC 4 cut(s) 366, 1578, 1826, 1903
Lsp1109I GCAGC 4 cut(s) 68, 147, 2012, 2040
MaeII ACGT 4 cut(s) 67, 327, 994, 1858
MaeIII GTNAC 2 cut(s) 712, 2035
MbiI CCGCTC 1 cut(s) 1352
MboII GAAGA 8 cut(s) 189, 579, 587, 757, 1471, 1568, 1823, 2026
MfeI CAATTG 1 cut(s) 1172
MflI RGATCY 2 cut(s) 1371, 1476
MhlI GDGCHC 4 cut(s) 1329, 1809, 1831, 1852
MlsI TGGCCA 1 cut(s) 279
MluNI TGGCCA 1 cut(s) 279
MlyI GAGTC 2 cut(s) 212, 2026
Mox20I TGGCCA 1 cut(s) 279
MroXI GAANNNNTTC 1 cut(s) 876
MscI TGGCCA 1 cut(s) 279
MseI TTAA 4 cut(s) 1034, 1077, 1659, 1680
MslI CAYNNNNRTG 2 cut(s) 824, 2126
Msp20I TGGCCA 1 cut(s) 279
MspA1I CMGCKG 1 cut(s) 2031
MspI CCGG 1 cut(s) 524
MspR9I CCNGG 7 cut(s) 244, 414, 507, 1024, 1297, 1713, 2022
MunI CAATTG 1 cut(s) 1172
MvaI CCWGG 7 cut(s) 244, 414, 507, 1024, 1297, 1713, 2022
MwoI GCNNNNNNNGC 9 cut(s) 285, 294, 851, 1214, 1346, 1696, 1804, 1847, 1877
NdeI CATATG 1 cut(s) 265
NheI GCTAGC 3 cut(s) 131, 1841, 2143
NlaIV GGNNCC 2 cut(s) 522, 1905
NmuCI GTSAC 1 cut(s) 2035
NspI RCATGY 1 cut(s) 1585
NspV TTCGAA 3 cut(s) 759, 1420, 1445
PaeI GCATGC 1 cut(s) 1585
PceI AGGCCT 1 cut(s) 1300
PciSI GCTCTTC 1 cut(s) 1836
PdmI GAANNNNTTC 1 cut(s) 876
PfeI GAWTC 4 cut(s) 570, 877, 1137, 1786
PfoI TCCNGGA 1 cut(s) 1022
PinAI ACCGGT 1 cut(s) 523
PkrI GCNGC 5 cut(s) 83, 137, 1351, 2027, 2030
PleI GAGTC 2 cut(s) 211, 2025
PpsI GAGTC 2 cut(s) 211, 2025
Ppu21I YACGTR 1 cut(s) 995
PsiI TTATAA 1 cut(s) 72
Psp124BI GAGCTC 1 cut(s) 1831
Psp6I CCWGG 7 cut(s) 242, 412, 505, 1022, 1295, 1711, 2020
PspFI CCCAGC 2 cut(s) 1814, 2031
PspGI CCWGG 7 cut(s) 242, 412, 505, 1022, 1295, 1711, 2020
PspN4I GGNNCC 2 cut(s) 522, 1905
PstI CTGCAG 1 cut(s) 2030
PstNI CAGNNNCTG 1 cut(s) 1891
PsuI RGATCY 2 cut(s) 1371, 1476
PvuII CAGCTG 1 cut(s) 2031
RsaI GTAC 2 cut(s) 406, 740
RsaNI GTAC 2 cut(s) 405, 739
RseI CAYNNNNRTG 2 cut(s) 824, 2126
SacI GAGCTC 1 cut(s) 1831
SapI GCTCTTC 1 cut(s) 1836
SaqAI TTAA 4 cut(s) 1034, 1077, 1659, 1680
SatI GCNGC 5 cut(s) 82, 136, 1350, 2026, 2029
SchI GAGTC 2 cut(s) 212, 2026
ScrFI CCNGG 7 cut(s) 244, 414, 507, 1024, 1297, 1713, 2022
SduI GDGCHC 4 cut(s) 1329, 1809, 1831, 1852
SfcI CTRYAG 2 cut(s) 55, 2026
SfuI TTCGAA 3 cut(s) 759, 1420, 1445
SmiMI CAYNNNNRTG 2 cut(s) 824, 2126
SmlI CTYRAG 2 cut(s) 99, 1141
SmoI CTYRAG 2 cut(s) 99, 1141
SnaBI TACGTA 1 cut(s) 995
SpeI ACTAGT 1 cut(s) 1654
SphI GCATGC 1 cut(s) 1585
SseBI AGGCCT 1 cut(s) 1300
SsiI CCGC 4 cut(s) 517, 563, 581, 1350
SstI GAGCTC 1 cut(s) 1831
StuI AGGCCT 1 cut(s) 1300
StyD4I CCNGG 7 cut(s) 242, 412, 505, 1022, 1295, 1711, 2020
StyI CCWWGG 1 cut(s) 1747
TaaI ACNGT 4 cut(s) 497, 709, 1083, 1507
TaiI ACGT 4 cut(s) 70, 330, 997, 1861
TauI GCSGC 1 cut(s) 1352
TfiI GAWTC 4 cut(s) 570, 877, 1137, 1786
Tru1I TTAA 4 cut(s) 1034, 1077, 1659, 1680
Tru9I TTAA 4 cut(s) 1034, 1077, 1659, 1680
TscAI CASTG 5 cut(s) 454, 518, 1327, 1336, 1392
TseFI GTSAC 1 cut(s) 2035
TseI GCWGC 4 cut(s) 81, 135, 2025, 2028
Tsp45I GTSAC 1 cut(s) 2035
TspRI CASTG 5 cut(s) 454, 518, 1327, 1336, 1392
XapI RAATTY 4 cut(s) 679, 934, 1027, 1996
XceI RCATGY 1 cut(s) 1585
XcmI CCANNNNNNNNNTGG 2 cut(s) 1547, 2028
XmiI GTMKAC 1 cut(s) 95
XmnI GAANNNNTTC 1 cut(s) 876
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.