Rmu_sc0002642.1_g000003
NAC Family

NAC domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002642.1
OG0012399
Physical Location & Seq
Forward (+)
20865 .. 24400
3536 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002642.1_g000003.1.cds

Sequence Viewer

Length: 1374 bp
atggccggaccttcgtggttggtggacaaaaagagaatcgcaacaaaaatcaggaatgcatctacaagtgatcctgcaagaatcaaatggcaaagcaatccaactagagcttgcccaaactgccaatatatgattgacaacagtgatgttgctcaagagtggccaggattacccaagggtgtgaaatttgatccaactgatcaagagattatatggcacttgcttgcaaaaactggtgcaggggatttgagaccccatccttttattgatgcatttatcacagactttgatgatgatgagggagtcttatgttcccatccaaagaaactaccaggtattaagcaagatggaagtgtatcccacttctttcatttagcaattaaggcttacaacactggaactcgaaagcgtcgaaaaatacatgatgatgagtatggtgatatccgctggcacaagactggaaggactaaaccagtgatcttggatggggttcaaagagggtgcaagaagattatggttctgtatacaagcatggccaaaggaggcaaagctgagaagaccaattgggtcatgcatcaatatcacctgggaactgatgaggatgagaaggatggggagtatgtaatttctaaaatatattaccagcaacagcaagtcaagcaagctgataaaactgatcaaaattctcctgaaactagtgatcctgtgattcaagcagatccagttactcccaagtcggtgattcctgaaactctggaccctgctttcaatttgggagaagatattcctgctgcttgcacagaacccaagtcaataactcctgaacctccacgccctgaaaggagacattctaatcttggtttgggggaagatactcatgttgcttccacagatccctttcttcaaatgcaactgaagcatcgtgatatggactttgttgaagatgaagttcatcatgaatatgaaaattctggctgtcatgatcaacacagcatagagattccaaatgatgaagcaataaacaacaatgtaaatcatactcaggaagatccaaagtggtgggacagtgagtcacagaatctgctggattcacaacaacttgtggaaggcttgtctttatgtgatgatcttcttcagagccaatctccaactaggggtgaacatggaaatggtgaaccagcacaggtcaaaccctgtcttgctgattatgctaagctaggagcagatgatttaaagaaggatctagaggagtgccaaaatattgtcctcgatcctgctaacatggaacttggaacacctccagatttccgacttagccagcttgaattcgaatcacaggaaagtttcctttcttggggtggcaaattggcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM

Protein Analysis

457

Amino Acids

51.46

Weight (kDa)

5.07

Isoelectric Point (pI)

46.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012399)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G25580
fragaria_vesca FvH4_4g28090 FvH4_4g28090
malus_domestica MD13G1046600.v1.1 MD16G1048300.v1.1
prunus_persica Prupe.1G305300_v2.0.a1 Prupe.1G305300_v2.0.a1
pyrus_communis pycom13g04080 pycom16g04220
rosa_chinensis RchiOBHm_Chr4g0435841
rosa_laevigata RLG00000006555
rosa_multiflora Rmu_sc0002642.1_g000003
rosa_roxburghii Rroxscaffold_5G00377020
rosa_rugosa Rorug04G0289900
rosa_samantha Rh4AG344200 Rh4BG353100 Rh4CG367500 Rh4DG347000
rosa_wichuraiana Rw4G030070

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 524
AciI CCGC 1 cut(s) 445
AclWI GGATC 8 cut(s) 65, 185, 695, 713, 887, 1043, 1248, 1265
AcoI YGGCCR 3 cut(s) 3, 161, 534
AcsI RAATTY 4 cut(s) 185, 682, 967, 1325
AcuI CTGAAG 2 cut(s) 935, 1118
AfiI CCNNNNNNNGG 2 cut(s) 1154, 1354
AgsI TTSAA 6 cut(s) 494, 713, 769, 905, 941, 1325
AhdI GACNNNNNGTC 1 cut(s) 1069
AhlI ACTAGT 1 cut(s) 695
AjnI CCWGG 3 cut(s) 163, 331, 585
AluBI AGCT 5 cut(s) 110, 551, 665, 1216, 1321
AluI AGCT 5 cut(s) 110, 551, 665, 1216, 1321
Alw26I GTCTC 2 cut(s) 244, 838
AlwI GGATC 8 cut(s) 65, 185, 695, 713, 887, 1043, 1248, 1265
AlwNI CAGNNNCTG 1 cut(s) 1081
AoxI GGCC 3 cut(s) 3, 161, 534
ApeKI GCWGC 1 cut(s) 791
ApoI RAATTY 4 cut(s) 185, 682, 967, 1325
Asp700I GAANNNNTTC 1 cut(s) 783
AspS9I GGNCC 2 cut(s) 8, 757
AsuHPI GGTGA 5 cut(s) 449, 575, 751, 1169, 1184
AsuII TTCGAA 1 cut(s) 1329
AvaII GGWCC 2 cut(s) 8, 757
BaeI ACNNNNGTAYC 2 cut(s) 864, 897
BalI TGGCCA 2 cut(s) 163, 536
BbsI GAAGAC 1 cut(s) 563
BbvI GCAGC 1 cut(s) 778
BccI CCATC 5 cut(s) 264, 324, 341, 479, 605
BciT130I CCWGG 3 cut(s) 165, 333, 587
BciVI GTATCC 1 cut(s) 367
BclI TGATCA 3 cut(s) 199, 676, 982
BcoDI GTCTC 2 cut(s) 244, 838
BcuI ACTAGT 1 cut(s) 695
BfaI CTAG 5 cut(s) 105, 696, 1152, 1217, 1244
BfuI GTATCC 1 cut(s) 367
BisI GCNGC 1 cut(s) 792
BlpI GCTNAGC 1 cut(s) 1212
BlsI GCNGC 1 cut(s) 793
Bme1390I CCNGG 3 cut(s) 165, 333, 587
Bme18I GGWCC 2 cut(s) 8, 757
BmeRI GACNNNNNGTC 1 cut(s) 1069
BmgT120I GGNCC 2 cut(s) 8, 757
BmiI GGNNCC 1 cut(s) 759
BmrFI CCNGG 3 cut(s) 165, 333, 587
BmsI GCATC 4 cut(s) 68, 259, 583, 928
BpiI GAAGAC 1 cut(s) 563
BplI GAGNNNNNCTC 2 cut(s) 1129, 1161
BpmI CTGGAG 1 cut(s) 1284
Bpu1102I GCTNAGC 1 cut(s) 1212
Bpu14I TTCGAA 1 cut(s) 1329
BpuEI CTTGAG 1 cut(s) 138
BsaI GGTCTC 1 cut(s) 244
BsaJI CCNNGG 2 cut(s) 174, 586
Bsc4I CCNNNNNNNGG 2 cut(s) 1154, 1354
Bse1I ACTGG 5 cut(s) 238, 400, 463, 473, 722
BseBI CCWGG 3 cut(s) 165, 333, 587
BseDI CCNNGG 2 cut(s) 174, 586
BseGI GGATG 5 cut(s) 256, 316, 490, 607, 616
BseLI CCNNNNNNNGG 2 cut(s) 1154, 1354
BseMII CTCAG 2 cut(s) 543, 1055
BseNI ACTGG 5 cut(s) 238, 400, 463, 473, 722
BseRI GAGGAG 1 cut(s) 1262
BseXI GCAGC 1 cut(s) 778
BsgI GTGCAG 1 cut(s) 258
BshFI GGCC 3 cut(s) 5, 163, 536
BsiSI CCGG 1 cut(s) 6
BslFI GGGAC 1 cut(s) 1076
BslI CCNNNNNNNGG 2 cut(s) 1154, 1354
BsmAI GTCTC 2 cut(s) 244, 838
BsmFI GGGAC 1 cut(s) 1076
BsmI GAATGC 1 cut(s) 61
BsnI GGCC 3 cut(s) 5, 163, 536
Bso31I GGTCTC 1 cut(s) 244
Bsp119I TTCGAA 1 cut(s) 1329
Bsp1720I GCTNAGC 1 cut(s) 1212
BspACI CCGC 1 cut(s) 445
BspANI GGCC 3 cut(s) 5, 163, 536
BspCNI CTCAG 2 cut(s) 544, 1054
BspHI TCATGA 2 cut(s) 955, 979
BspLI GGNNCC 1 cut(s) 759
BspPI GGATC 8 cut(s) 65, 185, 695, 713, 887, 1043, 1248, 1265
BspT104I TTCGAA 1 cut(s) 1329
BspTNI GGTCTC 1 cut(s) 244
BsrI ACTGG 5 cut(s) 238, 400, 463, 473, 722
BssECI CCNNGG 2 cut(s) 174, 586
BssNAI GTATAC 1 cut(s) 525
BssT1I CCWWGG 1 cut(s) 174
Bst1107I GTATAC 1 cut(s) 525
Bst2UI CCWGG 3 cut(s) 165, 333, 587
Bst4CI ACNGT 2 cut(s) 143, 1067
BstBI TTCGAA 1 cut(s) 1329
BstC8I GCNNGC 6 cut(s) 112, 225, 449, 663, 796, 1319
BstDEI CTNAG 5 cut(s) 552, 1041, 1212, 1313, 1371
BstF5I GGATG 5 cut(s) 256, 316, 490, 607, 616
BstMAI GTCTC 2 cut(s) 244, 838
BstMWI GCNNNNNNNGC 5 cut(s) 120, 383, 658, 916, 1208
BstNI CCWGG 3 cut(s) 165, 333, 587
BstSCI CCNGG 3 cut(s) 163, 331, 585
BstV1I GCAGC 1 cut(s) 778
BstV2I GAAGAC 1 cut(s) 563
BstX2I RGATCY 4 cut(s) 718, 892, 1048, 1240
BstXI CCANNNNNNTGG 1 cut(s) 1059
BstYI RGATCY 4 cut(s) 718, 892, 1048, 1240
BstZ17I GTATAC 1 cut(s) 525
BsuI GTATCC 1 cut(s) 367
BsuRI GGCC 3 cut(s) 5, 163, 536
BtsCI GGATG 5 cut(s) 256, 316, 490, 607, 616
BtsIMutI CAGTG 4 cut(s) 148, 393, 480, 1072
Cac8I GCNNGC 6 cut(s) 112, 225, 449, 663, 796, 1319
CaiI CAGNNNCTG 1 cut(s) 1081
CciI TCATGA 2 cut(s) 955, 979
Cfr13I GGNCC 2 cut(s) 8, 757
CseI GACGC 1 cut(s) 398
CsiI ACCWGGT 1 cut(s) 331
CviAII CATG 8 cut(s) 422, 532, 571, 878, 956, 980, 1163, 1282
DdeI CTNAG 5 cut(s) 552, 1041, 1212, 1313, 1371
DraI TTTAAA 1 cut(s) 1233
DriI GACNNNNNGTC 1 cut(s) 1069
EaeI YGGCCR 3 cut(s) 3, 161, 534
Eam1105I GACNNNNNGTC 1 cut(s) 1069
Eco130I CCWWGG 1 cut(s) 174
Eco31I GGTCTC 1 cut(s) 244
Eco32I GATATC 1 cut(s) 442
Eco47I GGWCC 2 cut(s) 8, 757
Eco57I CTGAAG 2 cut(s) 935, 1118
EcoRI GAATTC 1 cut(s) 1325
EcoRII CCWGG 3 cut(s) 163, 331, 585
EcoRV GATATC 1 cut(s) 442
EcoT14I CCWWGG 1 cut(s) 174
EcoT22I ATGCAT 3 cut(s) 61, 274, 576
ErhI CCWWGG 1 cut(s) 174
FaeI CATG 8 cut(s) 425, 535, 574, 881, 959, 983, 1166, 1285
FaqI GGGAC 1 cut(s) 1076
FatI CATG 8 cut(s) 421, 531, 570, 877, 955, 979, 1162, 1281
FbaI TGATCA 3 cut(s) 199, 676, 982
FblI GTMKAC 1 cut(s) 524
Fnu4HI GCNGC 1 cut(s) 792
FokI GGATG 5 cut(s) 243, 303, 497, 614, 623
Fsp4HI GCNGC 1 cut(s) 792
FspBI CTAG 5 cut(s) 105, 696, 1152, 1217, 1244
GluI GCNGC 1 cut(s) 792
GsuI CTGGAG 1 cut(s) 1284
HaeIII GGCC 3 cut(s) 5, 163, 536
HapII CCGG 1 cut(s) 6
HgaI GACGC 1 cut(s) 398
Hin1II CATG 8 cut(s) 425, 535, 574, 881, 959, 983, 1166, 1285
HpaII CCGG 1 cut(s) 6
HphI GGTGA 5 cut(s) 449, 575, 751, 1169, 1184
Hpy166II GTNNAC 4 cut(s) 25, 525, 1160, 1175
Hpy188I TCNGA 2 cut(s) 1137, 1310
Hpy8I GTNNAC 4 cut(s) 25, 525, 1160, 1175
Hpy99I CGWCG 1 cut(s) 414
HpyAV CCTTC 5 cut(s) 21, 456, 601, 1100, 1231
HpyCH4III ACNGT 2 cut(s) 143, 1067
HpyCH4V TGCA 9 cut(s) 59, 77, 227, 239, 272, 504, 574, 798, 910
HpyF10VI GCNNNNNNNGC 5 cut(s) 120, 383, 658, 916, 1208
HpyF3I CTNAG 5 cut(s) 552, 1041, 1212, 1313, 1371
Hsp92II CATG 8 cut(s) 425, 535, 574, 881, 959, 983, 1166, 1285
Ksp22I TGATCA 3 cut(s) 199, 676, 982
LmnI GCTCC 1 cut(s) 1220
Lsp1109I GCAGC 1 cut(s) 778
LweI GCATC 4 cut(s) 68, 259, 583, 928
MabI ACCWGGT 1 cut(s) 331
MaeI CTAG 5 cut(s) 105, 696, 1152, 1217, 1244
MaeIII GTNAC 2 cut(s) 724, 1071
MboII GAAGA 9 cut(s) 520, 568, 791, 881, 893, 953, 1058, 1121, 1124
MfeI CAATTG 1 cut(s) 562
MflI RGATCY 4 cut(s) 718, 892, 1048, 1240
MlsI TGGCCA 2 cut(s) 163, 536
MluCI AATT 9 cut(s) 185, 378, 562, 624, 682, 769, 967, 1325, 1364
MluNI TGGCCA 2 cut(s) 163, 536
MlyI GAGTC 2 cut(s) 312, 1079
MmeI TCCRAC 4 cut(s) 125, 218, 1172, 1333
MnlI CCTC 8 cut(s) 292, 491, 536, 592, 837, 1240, 1277, 1308
Mox20I TGGCCA 2 cut(s) 163, 536
Mph1103I ATGCAT 3 cut(s) 61, 274, 576
MroXI GAANNNNTTC 1 cut(s) 783
MscI TGGCCA 2 cut(s) 163, 536
MseI TTAA 3 cut(s) 339, 381, 1232
MslI CAYNNNNRTG 3 cut(s) 426, 960, 1167
Msp20I TGGCCA 2 cut(s) 163, 536
MspA1I CMGCKG 1 cut(s) 447
MspI CCGG 1 cut(s) 6
MspR9I CCNGG 3 cut(s) 165, 333, 587
MunI CAATTG 1 cut(s) 562
Mva1269I GAATGC 1 cut(s) 61
MvaI CCWGG 3 cut(s) 165, 333, 587
MwoI GCNNNNNNNGC 5 cut(s) 120, 383, 658, 916, 1208
NlaIII CATG 8 cut(s) 425, 535, 574, 881, 959, 983, 1166, 1285
NlaIV GGNNCC 1 cut(s) 759
NmuCI GTSAC 1 cut(s) 1071
NsiI ATGCAT 3 cut(s) 61, 274, 576
NspV TTCGAA 1 cut(s) 1329
PagI TCATGA 2 cut(s) 955, 979
PcsI WCGNNNNNNNCGW 1 cut(s) 409
PctI GAATGC 1 cut(s) 61
PdmI GAANNNNTTC 1 cut(s) 783
PfeI GAWTC 8 cut(s) 36, 81, 709, 742, 1000, 1078, 1088, 1331
PkrI GCNGC 1 cut(s) 793
PleI GAGTC 2 cut(s) 311, 1078
PpsI GAGTC 2 cut(s) 311, 1078
Psp6I CCWGG 3 cut(s) 163, 331, 585
PspGI CCWGG 3 cut(s) 163, 331, 585
PspN4I GGNNCC 1 cut(s) 759
PspPI GGNCC 2 cut(s) 8, 757
PstNI CAGNNNCTG 1 cut(s) 1081
PsuI RGATCY 4 cut(s) 718, 892, 1048, 1240
RseI CAYNNNNRTG 3 cut(s) 426, 960, 1167
SaqAI TTAA 3 cut(s) 339, 381, 1232
SatI GCNGC 1 cut(s) 792
Sau96I GGNCC 2 cut(s) 8, 757
SchI GAGTC 2 cut(s) 312, 1079
ScrFI CCNGG 3 cut(s) 165, 333, 587
SexAI ACCWGGT 1 cut(s) 331
SfaNI GCATC 4 cut(s) 68, 259, 583, 928
SfuI TTCGAA 1 cut(s) 1329
SinI GGWCC 2 cut(s) 8, 757
SmiMI CAYNNNNRTG 3 cut(s) 426, 960, 1167
SmlI CTYRAG 1 cut(s) 153
SmoI CTYRAG 1 cut(s) 153
SpeI ACTAGT 1 cut(s) 695
Sse9I AATT 9 cut(s) 185, 378, 562, 624, 682, 769, 967, 1325, 1364
SsiI CCGC 1 cut(s) 445
SspI AATATT 1 cut(s) 1261
SspMI CTAG 5 cut(s) 105, 696, 1152, 1217, 1244
StyD4I CCNGG 3 cut(s) 163, 331, 585
StyI CCWWGG 1 cut(s) 174
TaaI ACNGT 2 cut(s) 143, 1067
TaqI TCGA 4 cut(s) 403, 412, 1269, 1329
TasI AATT 9 cut(s) 185, 378, 562, 624, 682, 769, 967, 1325, 1364
TfiI GAWTC 8 cut(s) 36, 81, 709, 742, 1000, 1078, 1088, 1331
Tru1I TTAA 3 cut(s) 339, 381, 1232
Tru9I TTAA 3 cut(s) 339, 381, 1232
TscAI CASTG 4 cut(s) 148, 400, 480, 1072
TseFI GTSAC 1 cut(s) 1071
TseI GCWGC 1 cut(s) 791
Tsp45I GTSAC 1 cut(s) 1071
TspDTI ATGAA 6 cut(s) 359, 941, 960, 972, 978, 1026
TspRI CASTG 4 cut(s) 148, 400, 480, 1072
VpaK11BI GGWCC 2 cut(s) 8, 757
XapI RAATTY 4 cut(s) 185, 682, 967, 1325
XbaI TCTAGA 1 cut(s) 1243
XmiI GTMKAC 1 cut(s) 524
XmnI GAANNNNTTC 1 cut(s) 783
XspI CTAG 5 cut(s) 105, 696, 1152, 1217, 1244
Zsp2I ATGCAT 3 cut(s) 61, 274, 576
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.