Rmu_sc0003058.1_g000011

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003058.1
OG0009377
Physical Location & Seq
Reverse (-)
50099 .. 50661
563 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003058.1_g000011.1.cds

Sequence Viewer

Length: 258 bp
atgatgaaaggtgtgggaggaccgcttctatgcataggcgatctgctgagcgatgtgggagaatcagacgcttcacctccaccgcaacaccatgagccctcggcttctgcttctatttccacctctactagtcaaaacccggaccttaccaacttgttccaggagaactatgagcagctgaatgaggcgcttgccggtacagaccactcatgggcaggtcgtactctgaaggtgatgaattatcttttgaggatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.13

Weight (kDa)

4.63

Isoelectric Point (pI)

26.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 206
AciI CCGC 2 cut(s) 23, 83
AcuI CTGAAG 1 cut(s) 248
AfaI GTAC 2 cut(s) 199, 223
AfiI CCNNNNNNNGG 1 cut(s) 211
AhlI ACTAGT 1 cut(s) 128
AjnI CCWGG 1 cut(s) 159
AluBI AGCT 1 cut(s) 178
AluI AGCT 1 cut(s) 178
ApeKI GCWGC 1 cut(s) 175
AspLEI GCGC 1 cut(s) 190
AspS9I GGNCC 2 cut(s) 20, 142
AsuC2I CCSGG 1 cut(s) 140
AsuHPI GGTGA 2 cut(s) 66, 244
AvaII GGWCC 2 cut(s) 20, 142
BanII GRGCYC 1 cut(s) 99
BbvI GCAGC 1 cut(s) 187
BciT130I CCWGG 1 cut(s) 161
BcnI CCSGG 1 cut(s) 140
BcuI ACTAGT 1 cut(s) 128
BfaI CTAG 1 cut(s) 129
BfoI RGCGCY 1 cut(s) 191
BfuAI ACCTGC 1 cut(s) 206
BisI GCNGC 1 cut(s) 176
BlpI GCTNAGC 1 cut(s) 47
BlsI GCNGC 1 cut(s) 177
Bme1390I CCNGG 2 cut(s) 140, 161
Bme18I GGWCC 2 cut(s) 20, 142
BmgT120I GGNCC 2 cut(s) 20, 142
BmrFI CCNGG 2 cut(s) 140, 161
Bpu1102I GCTNAGC 1 cut(s) 47
BpuMI CCSGG 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 99
Bsc4I CCNNNNNNNGG 1 cut(s) 211
Bse118I RCCGGY 1 cut(s) 194
BseBI CCWGG 1 cut(s) 161
BseDI CCNNGG 1 cut(s) 99
BseLI CCNNNNNNNGG 1 cut(s) 211
BseMII CTCAG 1 cut(s) 38
BseXI GCAGC 1 cut(s) 187
BsiSI CCGG 2 cut(s) 140, 195
BslI CCNNNNNNNGG 1 cut(s) 211
Bsp1286I GDGCHC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 40
Bsp1720I GCTNAGC 1 cut(s) 47
BspACI CCGC 2 cut(s) 23, 83
BspCNI CTCAG 1 cut(s) 39
BspMI ACCTGC 1 cut(s) 206
BsrFI RCCGGY 1 cut(s) 194
BssAI RCCGGY 1 cut(s) 194
BssECI CCNNGG 1 cut(s) 99
BssMI GATC 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 161
BstC8I GCNNGC 1 cut(s) 192
BstDEI CTNAG 1 cut(s) 47
BstH2I RGCGCY 1 cut(s) 191
BstHHI GCGC 1 cut(s) 190
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstNI CCWGG 1 cut(s) 161
BstSCI CCNGG 2 cut(s) 138, 159
BstV1I GCAGC 1 cut(s) 187
BtgZI GCGATG 1 cut(s) 66
BveI ACCTGC 1 cut(s) 206
Cac8I GCNNGC 1 cut(s) 192
CfoI GCGC 1 cut(s) 190
Cfr10I RCCGGY 1 cut(s) 194
Cfr13I GGNCC 2 cut(s) 20, 142
CseI GACGC 1 cut(s) 77
Csp6I GTAC 2 cut(s) 198, 222
CviAII CATG 2 cut(s) 92, 210
CviJI RGCY 3 cut(s) 97, 104, 178
CviKI_1 RGCY 3 cut(s) 97, 104, 178
CviQI GTAC 2 cut(s) 198, 222
DdeI CTNAG 1 cut(s) 47
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco24I GRGCYC 1 cut(s) 99
Eco47I GGWCC 2 cut(s) 20, 142
Eco57I CTGAAG 1 cut(s) 248
EcoRII CCWGG 1 cut(s) 159
EcoT22I ATGCAT 1 cut(s) 35
EcoT38I GRGCYC 1 cut(s) 99
FaeI CATG 2 cut(s) 95, 213
FaiI YATR 6 cut(s) 31, 35, 93, 171, 211, 256
FatI CATG 2 cut(s) 91, 209
Fnu4HI GCNGC 1 cut(s) 176
FriOI GRGCYC 1 cut(s) 99
Fsp4HI GCNGC 1 cut(s) 176
FspBI CTAG 1 cut(s) 129
GlaI GCGC 1 cut(s) 189
GluI GCNGC 1 cut(s) 176
HaeII RGCGCY 1 cut(s) 191
HapII CCGG 2 cut(s) 140, 195
HgaI GACGC 1 cut(s) 77
HhaI GCGC 1 cut(s) 190
Hin1II CATG 2 cut(s) 95, 213
Hin6I GCGC 1 cut(s) 188
HinP1I GCGC 1 cut(s) 188
HinfI GANTC 1 cut(s) 62
HpaII CCGG 2 cut(s) 140, 195
HphI GGTGA 2 cut(s) 66, 244
Hpy188I TCNGA 2 cut(s) 67, 228
HpyAV CCTTC 1 cut(s) 223
HpyCH4V TGCA 1 cut(s) 33
HpyF3I CTNAG 1 cut(s) 47
Hsp92II CATG 2 cut(s) 95, 213
HspAI GCGC 1 cut(s) 188
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 5 cut(s) 146, 153, 173, 201, 208
Lsp1109I GCAGC 1 cut(s) 187
MaeI CTAG 1 cut(s) 129
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MhlI GDGCHC 1 cut(s) 99
MluCI AATT 1 cut(s) 238
MnlI CCTC 6 cut(s) 11, 87, 109, 133, 178, 243
Mph1103I ATGCAT 1 cut(s) 35
MspA1I CMGCKG 1 cut(s) 178
MspI CCGG 2 cut(s) 140, 195
MspR9I CCNGG 2 cut(s) 140, 161
MvaI CCWGG 1 cut(s) 161
NciI CCSGG 1 cut(s) 140
NdeII GATC 1 cut(s) 40
NlaIII CATG 2 cut(s) 95, 213
NmeAIII GCCGAG 1 cut(s) 80
NsiI ATGCAT 1 cut(s) 35
PfeI GAWTC 1 cut(s) 62
PfoI TCCNGGA 1 cut(s) 159
PkrI GCNGC 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 159
PspGI CCWGG 1 cut(s) 159
PspPI GGNCC 2 cut(s) 20, 142
PvuII CAGCTG 1 cut(s) 178
RsaI GTAC 2 cut(s) 199, 223
RsaNI GTAC 2 cut(s) 198, 222
SatI GCNGC 1 cut(s) 176
Sau3AI GATC 1 cut(s) 40
Sau96I GGNCC 2 cut(s) 20, 142
ScrFI CCNGG 2 cut(s) 140, 161
SduI GDGCHC 1 cut(s) 99
SetI ASST 7 cut(s) 13, 79, 125, 147, 180, 220, 234
SinI GGWCC 2 cut(s) 20, 142
SpeI ACTAGT 1 cut(s) 128
Sse9I AATT 1 cut(s) 238
SsiI CCGC 2 cut(s) 23, 83
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 2 cut(s) 138, 159
TasI AATT 1 cut(s) 238
TfiI GAWTC 1 cut(s) 62
TseI GCWGC 1 cut(s) 175
TspDTI ATGAA 2 cut(s) 20, 251
VpaK11BI GGWCC 2 cut(s) 20, 142
XspI CTAG 1 cut(s) 129
Zsp2I ATGCAT 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.