Rmu_sc0003065.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003065.1
OG0018258
Physical Location & Seq
Reverse (-)
5862 .. 6301
440 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003065.1_g000003.1.cds

Sequence Viewer

Length: 231 bp
atgatcatgaagaagaatgggttgatcttcaacatgagcggttcaagctcttgctacttcctactgaagttcctgatcgagctccgaggaccgaggagtaggactcgatcttttgagggacataagctccagatcgagctccgaggaccgatggtgtggcatcacggcgccattttaggttgggaagtcgcagttgaggcggggcttattggtgggagtggtggaggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.33

Weight (kDa)

9.86

Isoelectric Point (pI)

64.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 167
AccBSI CCGCTC 1 cut(s) 39
AciI CCGC 2 cut(s) 39, 200
AcuI CTGAAG 1 cut(s) 86
AcyI GRCGYC 1 cut(s) 168
AgsI TTSAA 2 cut(s) 31, 45
AluBI AGCT 4 cut(s) 48, 82, 127, 139
AluI AGCT 4 cut(s) 48, 82, 127, 139
Alw21I GWGCWC 2 cut(s) 84, 141
AspLEI GCGC 1 cut(s) 170
AspS9I GGNCC 2 cut(s) 89, 146
AvaII GGWCC 2 cut(s) 89, 146
BanI GGYRCC 1 cut(s) 167
BanII GRGCYC 2 cut(s) 84, 141
Bbv12I GWGCWC 2 cut(s) 84, 141
BccI CCATC 1 cut(s) 145
BceAI ACGGC 1 cut(s) 181
BclI TGATCA 1 cut(s) 3
BfoI RGCGCY 1 cut(s) 171
Bme18I GGWCC 2 cut(s) 89, 146
BmgT120I GGNCC 2 cut(s) 89, 146
BmiI GGNNCC 1 cut(s) 169
BmsI GCATC 1 cut(s) 169
BplI GAGNNNNNCTC 2 cut(s) 88, 120
BpmI CTGGAG 1 cut(s) 113
BsaHI GRCGYC 1 cut(s) 168
BsaJI CCNNGG 3 cut(s) 85, 92, 142
BsaXI ACNNNNNCTCC 2 cut(s) 111, 141
BseDI CCNNGG 3 cut(s) 85, 92, 142
BseRI GAGGAG 1 cut(s) 109
BshNI GGYRCC 1 cut(s) 167
BsiHKAI GWGCWC 2 cut(s) 84, 141
BslFI GGGAC 1 cut(s) 132
BsmFI GGGAC 1 cut(s) 132
Bsp1286I GDGCHC 2 cut(s) 84, 141
Bsp143I GATC 5 cut(s) 3, 24, 75, 107, 132
BspACI CCGC 2 cut(s) 39, 200
BspHI TCATGA 1 cut(s) 6
BspLI GGNNCC 1 cut(s) 169
BspT107I GGYRCC 1 cut(s) 167
BsrBI CCGCTC 1 cut(s) 39
BssECI CCNNGG 3 cut(s) 85, 92, 142
BssMI GATC 5 cut(s) 3, 24, 75, 107, 132
BssNI GRCGYC 1 cut(s) 168
BstACI GRCGYC 1 cut(s) 168
BstH2I RGCGCY 1 cut(s) 171
BstHHI GCGC 1 cut(s) 170
BstKTI GATC 5 cut(s) 6, 27, 78, 110, 135
BstMBI GATC 5 cut(s) 3, 24, 75, 107, 132
BstMWI GCNNNNNNNGC 2 cut(s) 45, 197
CciI TCATGA 1 cut(s) 6
CfoI GCGC 1 cut(s) 170
Cfr13I GGNCC 2 cut(s) 89, 146
CviAII CATG 2 cut(s) 7, 34
CviJI RGCY 5 cut(s) 48, 82, 127, 139, 205
CviKI_1 RGCY 5 cut(s) 48, 82, 127, 139, 205
DinI GGCGCC 1 cut(s) 169
DpnI GATC 5 cut(s) 5, 26, 77, 109, 134
DpnII GATC 5 cut(s) 3, 24, 75, 107, 132
Ecl136II GAGCTC 2 cut(s) 82, 139
Eco24I GRGCYC 2 cut(s) 84, 141
Eco47I GGWCC 2 cut(s) 89, 146
Eco53kI GAGCTC 2 cut(s) 82, 139
Eco57I CTGAAG 1 cut(s) 86
EcoICRI GAGCTC 2 cut(s) 82, 139
EcoT38I GRGCYC 2 cut(s) 84, 141
EgeI GGCGCC 1 cut(s) 169
EheI GGCGCC 1 cut(s) 169
FaeI CATG 2 cut(s) 10, 37
FaiI YATR 3 cut(s) 8, 35, 123
FaqI GGGAC 1 cut(s) 132
FatI CATG 2 cut(s) 6, 33
FauI CCCGC 1 cut(s) 193
FbaI TGATCA 1 cut(s) 3
FriOI GRGCYC 2 cut(s) 84, 141
GlaI GCGC 1 cut(s) 169
GsuI CTGGAG 1 cut(s) 113
HaeII RGCGCY 1 cut(s) 171
HhaI GCGC 1 cut(s) 170
Hin1I GRCGYC 1 cut(s) 168
Hin1II CATG 2 cut(s) 10, 37
Hin6I GCGC 1 cut(s) 168
HinP1I GCGC 1 cut(s) 168
HinfI GANTC 1 cut(s) 103
Hpy188I TCNGA 2 cut(s) 86, 143
Hpy188III TCNNGA 3 cut(s) 7, 73, 130
HpyF10VI GCNNNNNNNGC 2 cut(s) 45, 197
Hsp92I GRCGYC 1 cut(s) 168
Hsp92II CATG 2 cut(s) 10, 37
HspAI GCGC 1 cut(s) 168
KasI GGCGCC 1 cut(s) 167
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 5 cut(s) 3, 24, 75, 107, 132
LmnI GCTCC 3 cut(s) 87, 132, 144
LpnPI CCDG 2 cut(s) 86, 143
LweI GCATC 1 cut(s) 169
MalI GATC 5 cut(s) 5, 26, 77, 109, 134
MbiI CCGCTC 1 cut(s) 39
MboI GATC 5 cut(s) 3, 24, 75, 107, 132
MboII GAAGA 3 cut(s) 19, 22, 25
MhlI GDGCHC 2 cut(s) 84, 141
Mly113I GGCGCC 1 cut(s) 168
MlyI GAGTC 1 cut(s) 97
MnlI CCTC 6 cut(s) 80, 87, 109, 137, 190, 218
MwoI GCNNNNNNNGC 2 cut(s) 45, 197
NarI GGCGCC 1 cut(s) 168
NdeII GATC 5 cut(s) 3, 24, 75, 107, 132
NlaIII CATG 2 cut(s) 10, 37
NlaIV GGNNCC 1 cut(s) 169
PagI TCATGA 1 cut(s) 6
PleI GAGTC 1 cut(s) 97
PluTI GGCGCC 1 cut(s) 171
PpsI GAGTC 1 cut(s) 97
Psp124BI GAGCTC 2 cut(s) 84, 141
PspN4I GGNNCC 1 cut(s) 169
PspPI GGNCC 2 cut(s) 89, 146
SacI GAGCTC 2 cut(s) 84, 141
Sau3AI GATC 5 cut(s) 3, 24, 75, 107, 132
Sau96I GGNCC 2 cut(s) 89, 146
SchI GAGTC 1 cut(s) 97
SduI GDGCHC 2 cut(s) 84, 141
SetI ASST 5 cut(s) 50, 84, 129, 141, 181
SfaNI GCATC 1 cut(s) 169
SfoI GGCGCC 1 cut(s) 169
SinI GGWCC 2 cut(s) 89, 146
SsiI CCGC 2 cut(s) 39, 200
SspDI GGCGCC 1 cut(s) 167
SstI GAGCTC 2 cut(s) 84, 141
TaqI TCGA 3 cut(s) 78, 106, 135
TaqII GACCGA 2 cut(s) 106, 163
TspDTI ATGAA 1 cut(s) 23
VpaK11BI GGWCC 2 cut(s) 89, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.