Rmu_sc0006766.1_g000014

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006766.1
Physical Location & Seq
Reverse (-)
65208 .. 65647
440 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006766.1_g000014.1.cds

Sequence Viewer

Length: 231 bp
atgatcatgaagaagaatgggttgatcttcaacatgagcggttcaagctcttgctacttcctactgaagttcctgatcgagctccgaggaccgaggagttggactcgatcttttgagggacataagctccagatcgagctccgaggaccgatggtgtggcgtcacagcgccattttaggttgggaagtcgcagttgtggcggggcttattggtgggagtggtggagcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.39

Weight (kDa)

10.17

Isoelectric Point (pI)

59.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 39
AciI CCGC 2 cut(s) 39, 200
AcuI CTGAAG 1 cut(s) 86
AcyI GRCGYC 1 cut(s) 160
AgsI TTSAA 2 cut(s) 31, 45
AluBI AGCT 4 cut(s) 48, 82, 127, 139
AluI AGCT 4 cut(s) 48, 82, 127, 139
Alw21I GWGCWC 2 cut(s) 84, 141
AspLEI GCGC 1 cut(s) 170
AspS9I GGNCC 2 cut(s) 89, 146
AvaII GGWCC 2 cut(s) 89, 146
BanII GRGCYC 2 cut(s) 84, 141
Bbv12I GWGCWC 2 cut(s) 84, 141
BccI CCATC 1 cut(s) 145
BclI TGATCA 1 cut(s) 3
BfoI RGCGCY 1 cut(s) 171
Bme18I GGWCC 2 cut(s) 89, 146
BmgT120I GGNCC 2 cut(s) 89, 146
BplI GAGNNNNNCTC 2 cut(s) 88, 120
BpmI CTGGAG 1 cut(s) 113
BsaHI GRCGYC 1 cut(s) 160
BsaJI CCNNGG 3 cut(s) 85, 92, 142
BsaXI ACNNNNNCTCC 2 cut(s) 111, 141
BseDI CCNNGG 3 cut(s) 85, 92, 142
BseRI GAGGAG 1 cut(s) 109
BsiHKAI GWGCWC 2 cut(s) 84, 141
BslFI GGGAC 1 cut(s) 132
BsmFI GGGAC 1 cut(s) 132
Bsp1286I GDGCHC 2 cut(s) 84, 141
Bsp143I GATC 5 cut(s) 3, 24, 75, 107, 132
BspACI CCGC 2 cut(s) 39, 200
BspHI TCATGA 1 cut(s) 6
BsrBI CCGCTC 1 cut(s) 39
BssECI CCNNGG 3 cut(s) 85, 92, 142
BssMI GATC 5 cut(s) 3, 24, 75, 107, 132
BssNI GRCGYC 1 cut(s) 160
BstACI GRCGYC 1 cut(s) 160
BstH2I RGCGCY 1 cut(s) 171
BstHHI GCGC 1 cut(s) 170
BstKTI GATC 5 cut(s) 6, 27, 78, 110, 135
BstMBI GATC 5 cut(s) 3, 24, 75, 107, 132
BstMWI GCNNNNNNNGC 2 cut(s) 45, 197
CciI TCATGA 1 cut(s) 6
CfoI GCGC 1 cut(s) 170
Cfr13I GGNCC 2 cut(s) 89, 146
CseI GACGC 1 cut(s) 149
CviAII CATG 3 cut(s) 7, 34, 228
CviJI RGCY 5 cut(s) 48, 82, 127, 139, 205
CviKI_1 RGCY 5 cut(s) 48, 82, 127, 139, 205
DpnI GATC 5 cut(s) 5, 26, 77, 109, 134
DpnII GATC 5 cut(s) 3, 24, 75, 107, 132
Ecl136II GAGCTC 2 cut(s) 82, 139
Eco24I GRGCYC 2 cut(s) 84, 141
Eco47I GGWCC 2 cut(s) 89, 146
Eco53kI GAGCTC 2 cut(s) 82, 139
Eco57I CTGAAG 1 cut(s) 86
EcoICRI GAGCTC 2 cut(s) 82, 139
EcoT38I GRGCYC 2 cut(s) 84, 141
FaeI CATG 3 cut(s) 10, 37, 231
FaiI YATR 4 cut(s) 8, 35, 123, 229
FaqI GGGAC 1 cut(s) 132
FatI CATG 3 cut(s) 6, 33, 227
FauI CCCGC 1 cut(s) 193
FbaI TGATCA 1 cut(s) 3
FriOI GRGCYC 2 cut(s) 84, 141
GlaI GCGC 1 cut(s) 169
GsuI CTGGAG 1 cut(s) 113
HaeII RGCGCY 1 cut(s) 171
HgaI GACGC 1 cut(s) 149
HhaI GCGC 1 cut(s) 170
Hin1I GRCGYC 1 cut(s) 160
Hin1II CATG 3 cut(s) 10, 37, 231
Hin6I GCGC 1 cut(s) 168
HinP1I GCGC 1 cut(s) 168
HinfI GANTC 1 cut(s) 103
Hpy188I TCNGA 2 cut(s) 86, 143
Hpy188III TCNNGA 3 cut(s) 7, 73, 130
HpyF10VI GCNNNNNNNGC 2 cut(s) 45, 197
Hsp92I GRCGYC 1 cut(s) 160
Hsp92II CATG 3 cut(s) 10, 37, 231
HspAI GCGC 1 cut(s) 168
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 5 cut(s) 3, 24, 75, 107, 132
LmnI GCTCC 4 cut(s) 87, 132, 144, 224
LpnPI CCDG 2 cut(s) 86, 143
MaeIII GTNAC 1 cut(s) 161
MalI GATC 5 cut(s) 5, 26, 77, 109, 134
MbiI CCGCTC 1 cut(s) 39
MboI GATC 5 cut(s) 3, 24, 75, 107, 132
MboII GAAGA 3 cut(s) 19, 22, 25
MhlI GDGCHC 2 cut(s) 84, 141
MlyI GAGTC 1 cut(s) 97
MmeI TCCRAC 1 cut(s) 80
MnlI CCTC 4 cut(s) 80, 87, 109, 137
MwoI GCNNNNNNNGC 2 cut(s) 45, 197
NdeII GATC 5 cut(s) 3, 24, 75, 107, 132
NlaIII CATG 3 cut(s) 10, 37, 231
NmuCI GTSAC 1 cut(s) 161
PagI TCATGA 1 cut(s) 6
PleI GAGTC 1 cut(s) 97
PpsI GAGTC 1 cut(s) 97
Psp124BI GAGCTC 2 cut(s) 84, 141
PspPI GGNCC 2 cut(s) 89, 146
SacI GAGCTC 2 cut(s) 84, 141
Sau3AI GATC 5 cut(s) 3, 24, 75, 107, 132
Sau96I GGNCC 2 cut(s) 89, 146
SchI GAGTC 1 cut(s) 97
SduI GDGCHC 2 cut(s) 84, 141
SetI ASST 5 cut(s) 50, 84, 129, 141, 181
SinI GGWCC 2 cut(s) 89, 146
SsiI CCGC 2 cut(s) 39, 200
SstI GAGCTC 2 cut(s) 84, 141
TaqI TCGA 3 cut(s) 78, 106, 135
TaqII GACCGA 2 cut(s) 106, 163
TseFI GTSAC 1 cut(s) 161
Tsp45I GTSAC 1 cut(s) 161
TspDTI ATGAA 1 cut(s) 23
VpaK11BI GGWCC 2 cut(s) 89, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.