Rmu_sc0003115.1_g000042

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003115.1
Physical Location & Seq
Reverse (-)
200261 .. 201646
1386 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003115.1_g000042.1.cds

Sequence Viewer

Length: 1029 bp
atgtcagaatctcatcattcttcttctgttgaacttcccatgctagacatctctcagcccttgaacccattatcttctgatttgccttctctttctgaagccttgaaaacatggggtttcttccacatcaccaatcatgggatctccaaagatcttttcacaaaactacaaaaactttcaaatcacctcttcagcctcccttctgataccaaactcaaacttggtcctttctcttctataaaaagttatacccctcatttcatagcctcccccttctttgaaagcctcagagtttctggcccaaagttctctgagtctgctcaaacttctgcggatgttctctttgaccaacacaactctgaattcagtgaggtattacatgaatatgggagcaagatggcagaattgtctcaaaaaatcataaagattgctttgatgagcttgggggaggattttgagaaaaaatactatgaatctgaatttcagaattgccatggttacttgagaatgaataactactcatcaccttcagaaggtttagaagatcatgatgaggttgaaggacttggaatgcacaccgacatgagctgtgtgacaattgtgtaccaagatgaaattggtggacttcaagtgagatcaaaagagggtaagtggatggacataatcccatgtgagggaaccttggtggtgaacgtaggtgacatgtttcaagcttggagcaatgagaagttgagatcatcagaacatagagtgattctcaagcagcctgtaaaccgcttttcgctagccttcttctggtgttttgaagatcagaaggtgatttctgcaccagatgatgtggtgggagaagggaatgtgaggatttacgagccatttgtttgctcggattatttgaaattcagagagagcaatgagagagggaggtttgagaaggttgggtttacagtgaggggttttgcagggattaaagaccagcaagttataaaatgtaacagtggaaaaggaattggaagtgtggcttgtaattag

Protein Analysis

342

Amino Acids

38.55

Weight (kDa)

5.49

Isoelectric Point (pI)

42.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014195)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G23340 AT4G23340
fragaria_vesca FvH4_7g14240
malus_domestica MD01G1060300.v1.1 MD07G1137400.v1.1
prunus_persica Prupe.2G170200_v2.0.a1
pyrus_communis pycom01g09040
rosa_chinensis RchiOBHm_Chr1g0355221
rosa_laevigata RLG00000028170
rosa_multiflora Rmu_sc0003115.1_g000042
rosa_roxburghii Rroxscaffold_4G00300580
rosa_rugosa Rorug01G0245600
rosa_samantha Rh1AG258100 Rh1BG227700 Rh1CG241800 Rh1DG255500
rosa_wichuraiana Rw1G022770

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 983
AciI CCGC 2 cut(s) 332, 775
AclWI GGATC 1 cut(s) 149
AcsI RAATTY 3 cut(s) 362, 479, 896
AcuI CTGAAG 3 cut(s) 117, 175, 513
AfaI GTAC 1 cut(s) 605
AfiI CCNNNNNNNGG 5 cut(s) 138, 533, 673, 674, 795
AflIII ACRYGT 1 cut(s) 702
AjuI GAANNNNNNNTTGG 2 cut(s) 140, 172
AluBI AGCT 3 cut(s) 441, 588, 713
AluI AGCT 3 cut(s) 441, 588, 713
Alw26I GTCTC 1 cut(s) 414
AlwI GGATC 1 cut(s) 149
AoxI GGCC 1 cut(s) 298
ApeKI GCWGC 1 cut(s) 763
ApoI RAATTY 3 cut(s) 362, 479, 896
AspS9I GGNCC 2 cut(s) 224, 299
AsuHPI GGTGA 6 cut(s) 121, 176, 516, 700, 710, 829
AsuNHI GCTAGC 1 cut(s) 784
AvaII GGWCC 1 cut(s) 224
BbvI GCAGC 1 cut(s) 775
BccI CCATC 2 cut(s) 391, 649
BcoDI GTCTC 1 cut(s) 414
BfaI CTAG 2 cut(s) 44, 785
BglII AGATCT 1 cut(s) 151
BisI GCNGC 1 cut(s) 764
BlsI GCNGC 1 cut(s) 765
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 2 cut(s) 224, 299
BmiI GGNNCC 1 cut(s) 679
BmtI GCTAGC 1 cut(s) 788
BplI GAGNNNNNCTC 2 cut(s) 741, 773
BpuEI CTTGAG 2 cut(s) 523, 743
BsaJI CCNNGG 2 cut(s) 493, 681
Bsc4I CCNNNNNNNGG 5 cut(s) 138, 533, 673, 674, 795
Bse3DI GCAATG 2 cut(s) 727, 916
BseDI CCNNGG 2 cut(s) 493, 681
BseGI GGATG 2 cut(s) 340, 660
BseLI CCNNNNNNNGG 5 cut(s) 138, 533, 673, 674, 795
BseMI GCAATG 2 cut(s) 727, 916
BseMII CTCAG 3 cut(s) 68, 301, 303
BseXI GCAGC 1 cut(s) 775
BsgI GTGCAG 1 cut(s) 810
BshFI GGCC 1 cut(s) 300
BslI CCNNNNNNNGG 5 cut(s) 138, 533, 673, 674, 795
BsmAI GTCTC 1 cut(s) 414
BsmI GAATGC 1 cut(s) 576
BsnI GGCC 1 cut(s) 300
Bsp143I GATC 6 cut(s) 141, 151, 544, 635, 734, 808
Bsp19I CCATGG 1 cut(s) 493
BspACI CCGC 2 cut(s) 332, 775
BspANI GGCC 1 cut(s) 300
BspCNI CTCAG 3 cut(s) 67, 300, 304
BspHI TCATGA 1 cut(s) 547
BspLI GGNNCC 1 cut(s) 679
BspOI GCTAGC 1 cut(s) 788
BspPI GGATC 1 cut(s) 149
BsrDI GCAATG 2 cut(s) 727, 916
BssECI CCNNGG 2 cut(s) 493, 681
BssMI GATC 6 cut(s) 141, 151, 544, 635, 734, 808
BssT1I CCWWGG 2 cut(s) 493, 681
Bst4CI ACNGT 2 cut(s) 946, 995
Bst6I CTCTTC 2 cut(s) 194, 238
BstC8I GCNNGC 1 cut(s) 786
BstDEI CTNAG 3 cut(s) 54, 287, 312
BstDSI CCRYGG 1 cut(s) 493
BstENI CCTNNNNNAGG 1 cut(s) 531
BstF5I GGATG 2 cut(s) 340, 660
BstKTI GATC 6 cut(s) 144, 154, 547, 638, 737, 811
BstMAI GTCTC 1 cut(s) 414
BstMBI GATC 6 cut(s) 141, 151, 544, 635, 734, 808
BstNSI RCATGY 1 cut(s) 706
BstV1I GCAGC 1 cut(s) 775
BstX2I RGATCY 2 cut(s) 141, 151
BstYI RGATCY 2 cut(s) 141, 151
BsuRI GGCC 1 cut(s) 300
BtgI CCRYGG 1 cut(s) 493
BtsCI GGATG 2 cut(s) 340, 660
BtsIMutI CAGTG 3 cut(s) 373, 951, 1000
Cac8I GCNNGC 1 cut(s) 786
CciI TCATGA 1 cut(s) 547
Cfr13I GGNCC 2 cut(s) 224, 299
Csp6I GTAC 1 cut(s) 604
CviAII CATG 9 cut(s) 40, 111, 137, 380, 494, 548, 583, 669, 703
CviQI GTAC 1 cut(s) 604
DdeI CTNAG 3 cut(s) 54, 287, 312
DpnI GATC 6 cut(s) 143, 153, 546, 637, 736, 810
DpnII GATC 6 cut(s) 141, 151, 544, 635, 734, 808
Eam1104I CTCTTC 2 cut(s) 194, 238
EarI CTCTTC 2 cut(s) 194, 238
Eco130I CCWWGG 2 cut(s) 493, 681
Eco47I GGWCC 1 cut(s) 224
Eco57I CTGAAG 3 cut(s) 117, 175, 513
EcoNI CCTNNNNNAGG 1 cut(s) 531
EcoRI GAATTC 1 cut(s) 362
EcoT14I CCWWGG 2 cut(s) 493, 681
ErhI CCWWGG 2 cut(s) 493, 681
FaeI CATG 9 cut(s) 43, 114, 140, 383, 497, 551, 586, 672, 706
FalI AAGNNNNNCTT 1 cut(s) 1003
FatI CATG 9 cut(s) 39, 110, 136, 379, 493, 547, 582, 668, 702
Fnu4HI GCNGC 1 cut(s) 764
FokI GGATG 2 cut(s) 347, 667
Fsp4HI GCNGC 1 cut(s) 764
FspBI CTAG 2 cut(s) 44, 785
GluI GCNGC 1 cut(s) 764
HaeIII GGCC 1 cut(s) 300
Hin1II CATG 9 cut(s) 43, 114, 140, 383, 497, 551, 586, 672, 706
HindIII AAGCTT 1 cut(s) 711
HinfI GANTC 4 cut(s) 8, 314, 473, 754
HphI GGTGA 6 cut(s) 121, 176, 516, 700, 710, 829
Hpy166II GTNNAC 5 cut(s) 604, 623, 691, 772, 942
Hpy188III TCNNGA 1 cut(s) 548
Hpy8I GTNNAC 5 cut(s) 604, 623, 691, 772, 942
HpyCH4III ACNGT 2 cut(s) 946, 995
HpyCH4IV ACGT 1 cut(s) 693
HpyCH4V TGCA 3 cut(s) 574, 827, 959
HpyF3I CTNAG 3 cut(s) 54, 287, 312
HpySE526I ACGT 1 cut(s) 693
Hsp92II CATG 9 cut(s) 43, 114, 140, 383, 497, 551, 586, 672, 706
Kzo9I GATC 6 cut(s) 141, 151, 544, 635, 734, 808
LmnI GCTCC 2 cut(s) 390, 717
LpnPI CCDG 6 cut(s) 282, 780, 781, 843, 945, 986
Lsp1109I GCAGC 1 cut(s) 775
MaeI CTAG 2 cut(s) 44, 785
MaeII ACGT 1 cut(s) 693
MaeIII GTNAC 4 cut(s) 497, 592, 698, 989
MalI GATC 6 cut(s) 143, 153, 546, 637, 736, 810
MboI GATC 6 cut(s) 141, 151, 544, 635, 734, 808
MboII GAAGA 9 cut(s) 12, 15, 66, 112, 181, 225, 554, 784, 818
MfeI CAATTG 1 cut(s) 597
MflI RGATCY 2 cut(s) 141, 151
MluCI AATT 9 cut(s) 362, 404, 479, 487, 597, 615, 896, 1005, 1024
MlyI GAGTC 1 cut(s) 323
MseI TTAA 1 cut(s) 966
MslI CAYNNNNRTG 2 cut(s) 384, 581
MunI CAATTG 1 cut(s) 597
Mva1269I GAATGC 1 cut(s) 576
NcoI CCATGG 1 cut(s) 493
NdeII GATC 6 cut(s) 141, 151, 544, 635, 734, 808
NheI GCTAGC 1 cut(s) 784
NlaIII CATG 9 cut(s) 43, 114, 140, 383, 497, 551, 586, 672, 706
NlaIV GGNNCC 1 cut(s) 679
NmuCI GTSAC 2 cut(s) 592, 698
NspI RCATGY 1 cut(s) 706
PagI TCATGA 1 cut(s) 547
PciI ACATGT 1 cut(s) 702
PctI GAATGC 1 cut(s) 576
PfeI GAWTC 3 cut(s) 8, 473, 754
PkrI GCNGC 1 cut(s) 765
PleI GAGTC 1 cut(s) 322
PpsI GAGTC 1 cut(s) 322
PscI ACATGT 1 cut(s) 702
PsiI TTATAA 1 cut(s) 983
PspN4I GGNNCC 1 cut(s) 679
PspPI GGNCC 2 cut(s) 224, 299
PsuI RGATCY 2 cut(s) 141, 151
RsaI GTAC 1 cut(s) 605
RsaNI GTAC 1 cut(s) 604
RseI CAYNNNNRTG 2 cut(s) 384, 581
SaqAI TTAA 1 cut(s) 966
SatI GCNGC 1 cut(s) 764
Sau3AI GATC 6 cut(s) 141, 151, 544, 635, 734, 808
Sau96I GGNCC 2 cut(s) 224, 299
SchI GAGTC 1 cut(s) 323
SinI GGWCC 1 cut(s) 224
SmiMI CAYNNNNRTG 2 cut(s) 384, 581
SmlI CTYRAG 2 cut(s) 502, 758
SmoI CTYRAG 2 cut(s) 502, 758
Sse9I AATT 9 cut(s) 362, 404, 479, 487, 597, 615, 896, 1005, 1024
SsiI CCGC 2 cut(s) 332, 775
SspMI CTAG 2 cut(s) 44, 785
StyI CCWWGG 2 cut(s) 493, 681
TaaI ACNGT 2 cut(s) 946, 995
TaiI ACGT 1 cut(s) 696
TasI AATT 9 cut(s) 362, 404, 479, 487, 597, 615, 896, 1005, 1024
TfiI GAWTC 3 cut(s) 8, 473, 754
Tru1I TTAA 1 cut(s) 966
Tru9I TTAA 1 cut(s) 966
TscAI CASTG 3 cut(s) 373, 951, 1000
TseFI GTSAC 2 cut(s) 592, 698
TseI GCWGC 1 cut(s) 763
Tsp45I GTSAC 2 cut(s) 592, 698
TspDTI ATGAA 5 cut(s) 250, 396, 486, 524, 627
TspRI CASTG 3 cut(s) 373, 951, 1000
VpaK11BI GGWCC 1 cut(s) 224
XagI CCTNNNNNAGG 1 cut(s) 531
XapI RAATTY 3 cut(s) 362, 479, 896
XceI RCATGY 1 cut(s) 706
XcmI CCANNNNNNNNNTGG 1 cut(s) 614
XspI CTAG 2 cut(s) 44, 785
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.