Rmu_sc0003163.1_g000004

Protein LIGHT-DEPENDENT SHORT HYPOCOTYLS

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003163.1
Physical Location & Seq
Reverse (-)
22495 .. 23130
636 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003163.1_g000004.1.cds

Sequence Viewer

Length: 636 bp
atggattcaatcccagatatggatgactcccccaactctacagagcacacaattcagaaccataacctaattatgaccacagctggcatgatgatgaacagcggcgcagctagttctggtgtgacactagcagcttcggcttcttcttcttcatcttctcctggttccagtagccgctacgagaaccaaaagcgccgtgactggaacaccttcgggcagtacctgaagaaccaccgccctccgctctccctctcccgctgcagcggcgctcatgttctcgagttcctccgctacctcgaccagttcggcaagacaaaagtccacactccaatctgccccttctatggccaccccaaccctcccgccccctgcccctgcccgctccgccaggcctggggcagcctggacgctctcatcggccgtcttcgagccgcctttgaggagaacggaggcaagcccgaagccaaccctttcggagctagagccgttaggctctacctccgtgaggttcgggacctgcagtccaaagcaagaggaatcagctacgagaagaagaagcggaagcgcccgccgctgccgcaacagttgcctccaccgactcagcatcagccttctcctggtgccagctgtcaataa

Protein Analysis

211

Amino Acids

23.2

Weight (kDa)

9.64

Isoelectric Point (pI)

56.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011647)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 525
AccB1I GGYRCC 1 cut(s) 620
AccBSI CCGCTC 2 cut(s) 244, 382
AcoI YGGCCR 2 cut(s) 346, 418
AcuI CTGAAG 1 cut(s) 245
AfaI GTAC 1 cut(s) 221
AfiI CCNNNNNNNGG 5 cut(s) 19, 344, 394, 505, 617
AgsI TTSAA 1 cut(s) 9
AhdI GACNNNNNGTC 1 cut(s) 520
AjnI CCWGG 5 cut(s) 160, 387, 392, 402, 616
AluBI AGCT 6 cut(s) 83, 110, 134, 479, 543, 627
AluI AGCT 6 cut(s) 83, 110, 134, 479, 543, 627
Alw21I GWGCWC 1 cut(s) 48
AlwNI CAGNNNCTG 1 cut(s) 223
Ama87I CYCGRG 1 cut(s) 278
AoxI GGCC 3 cut(s) 346, 390, 418
ApeKI GCWGC 6 cut(s) 107, 131, 258, 261, 399, 574
Asp700I GAANNNNTTC 1 cut(s) 209
AspLEI GCGC 4 cut(s) 107, 195, 269, 567
AspS9I GGNCC 1 cut(s) 514
AvaI CYCGRG 1 cut(s) 278
AvaII GGWCC 1 cut(s) 514
BalI TGGCCA 1 cut(s) 348
BanI GGYRCC 1 cut(s) 620
BbsI GAAGAC 1 cut(s) 416
Bbv12I GWGCWC 1 cut(s) 48
BbvI GCAGC 6 cut(s) 119, 143, 245, 273, 411, 561
BceAI ACGGC 3 cut(s) 180, 405, 470
BciT130I CCWGG 5 cut(s) 162, 389, 394, 404, 618
BfaI CTAG 3 cut(s) 111, 128, 480
BfmI CTRYAG 3 cut(s) 39, 259, 518
BfoI RGCGCY 3 cut(s) 196, 270, 568
BfuAI ACCTGC 1 cut(s) 525
Bme1390I CCNGG 5 cut(s) 162, 389, 394, 404, 618
Bme18I GGWCC 1 cut(s) 514
BmeRI GACNNNNNGTC 1 cut(s) 520
BmeT110I CYCGRG 1 cut(s) 278
BmgT120I GGNCC 1 cut(s) 514
BmiI GGNNCC 3 cut(s) 166, 515, 622
BmrFI CCNGG 5 cut(s) 162, 389, 394, 404, 618
BmsI GCATC 1 cut(s) 613
BoxI GACNNNNGTC 1 cut(s) 317
BpiI GAAGAC 1 cut(s) 416
BsaJI CCNNGG 1 cut(s) 393
Bsc4I CCNNNNNNNGG 5 cut(s) 19, 344, 394, 505, 617
Bse1I ACTGG 3 cut(s) 168, 206, 301
BseBI CCWGG 5 cut(s) 162, 389, 394, 404, 618
BseDI CCNNGG 1 cut(s) 393
BseGI GGATG 1 cut(s) 28
BseLI CCNNNNNNNGG 5 cut(s) 19, 344, 394, 505, 617
BseMII CTCAG 1 cut(s) 614
BseNI ACTGG 3 cut(s) 168, 206, 301
BseRI GAGGAG 1 cut(s) 455
BseX3I CGGCCG 1 cut(s) 418
BseXI GCAGC 6 cut(s) 119, 143, 245, 273, 411, 561
Bsh1285I CGRYCG 1 cut(s) 421
BshFI GGCC 3 cut(s) 348, 392, 420
BshNI GGYRCC 1 cut(s) 620
BsiEI CGRYCG 1 cut(s) 421
BsiHKAI GWGCWC 1 cut(s) 48
BsiHKCI CYCGRG 1 cut(s) 278
BslFI GGGAC 1 cut(s) 527
BslI CCNNNNNNNGG 5 cut(s) 19, 344, 394, 505, 617
BsmFI GGGAC 1 cut(s) 527
BsnI GGCC 3 cut(s) 348, 392, 420
BsoBI CYCGRG 1 cut(s) 278
Bsp1286I GDGCHC 1 cut(s) 48
BspANI GGCC 3 cut(s) 348, 392, 420
BspCNI CTCAG 1 cut(s) 613
BspLI GGNNCC 3 cut(s) 166, 515, 622
BspMAI CTGCAG 2 cut(s) 263, 522
BspMI ACCTGC 1 cut(s) 525
BspT107I GGYRCC 1 cut(s) 620
BsrBI CCGCTC 2 cut(s) 244, 382
BsrI ACTGG 3 cut(s) 168, 206, 301
BssECI CCNNGG 1 cut(s) 393
Bst2UI CCWGG 5 cut(s) 162, 389, 394, 404, 618
Bst4CI ACNGT 1 cut(s) 585
BstAPI GCANNNNNTGC 1 cut(s) 586
BstC8I GCNNGC 5 cut(s) 85, 380, 455, 569, 625
BstDEI CTNAG 1 cut(s) 600
BstENI CCTNNNNNAGG 1 cut(s) 503
BstF5I GGATG 1 cut(s) 28
BstH2I RGCGCY 3 cut(s) 196, 270, 568
BstHHI GCGC 4 cut(s) 107, 195, 269, 567
BstMCI CGRYCG 1 cut(s) 421
BstMWI GCNNNNNNNGC 6 cut(s) 137, 264, 384, 571, 577, 586
BstNI CCWGG 5 cut(s) 162, 389, 394, 404, 618
BstPAI GACNNNNGTC 1 cut(s) 317
BstSCI CCNGG 5 cut(s) 160, 387, 392, 402, 616
BstSFI CTRYAG 3 cut(s) 39, 259, 518
BstV1I GCAGC 6 cut(s) 119, 143, 245, 273, 411, 561
BstV2I GAAGAC 1 cut(s) 416
BstZI CGGCCG 1 cut(s) 418
BsuRI GGCC 3 cut(s) 348, 392, 420
BtsCI GGATG 1 cut(s) 28
BveI ACCTGC 1 cut(s) 525
Cac8I GCNNGC 5 cut(s) 85, 380, 455, 569, 625
CaiI CAGNNNCTG 1 cut(s) 223
CfoI GCGC 4 cut(s) 107, 195, 269, 567
Cfr13I GGNCC 1 cut(s) 514
CseI GACGC 1 cut(s) 416
Csp6I GTAC 1 cut(s) 220
CviAII CATG 2 cut(s) 88, 272
CviQI GTAC 1 cut(s) 220
DdeI CTNAG 1 cut(s) 600
DriI GACNNNNNGTC 1 cut(s) 520
EaeI YGGCCR 2 cut(s) 346, 418
EagI CGGCCG 1 cut(s) 418
Eam1105I GACNNNNNGTC 1 cut(s) 520
EciI GGCGGA 1 cut(s) 374
EclXI CGGCCG 1 cut(s) 418
Eco147I AGGCCT 1 cut(s) 392
Eco47I GGWCC 1 cut(s) 514
Eco52I CGGCCG 1 cut(s) 418
Eco57I CTGAAG 1 cut(s) 245
Eco88I CYCGRG 1 cut(s) 278
EcoNI CCTNNNNNAGG 1 cut(s) 503
EcoO109I RGGNCCY 1 cut(s) 514
EcoRII CCWGG 5 cut(s) 160, 387, 392, 402, 616
FaeI CATG 2 cut(s) 91, 275
FaiI YATR 6 cut(s) 20, 63, 74, 89, 273, 345
FaqI GGGAC 1 cut(s) 527
FatI CATG 2 cut(s) 87, 271
FauI CCCGC 4 cut(s) 263, 370, 387, 576
FokI GGATG 1 cut(s) 35
FspBI CTAG 3 cut(s) 111, 128, 480
GlaI GCGC 4 cut(s) 106, 194, 268, 566
HaeII RGCGCY 3 cut(s) 196, 270, 568
HaeIII GGCC 3 cut(s) 348, 392, 420
HgaI GACGC 1 cut(s) 416
HhaI GCGC 4 cut(s) 107, 195, 269, 567
Hin1II CATG 2 cut(s) 91, 275
Hin6I GCGC 4 cut(s) 105, 193, 267, 565
HinP1I GCGC 4 cut(s) 105, 193, 267, 565
HinfI GANTC 4 cut(s) 5, 26, 537, 598
Hpy166II GTNNAC 1 cut(s) 322
Hpy188I TCNGA 2 cut(s) 57, 476
Hpy188III TCNNGA 2 cut(s) 278, 512
Hpy8I GTNNAC 1 cut(s) 322
HpyAV CCTTC 3 cut(s) 220, 349, 621
HpyCH4III ACNGT 1 cut(s) 585
HpyCH4V TGCA 2 cut(s) 261, 520
HpyF10VI GCNNNNNNNGC 6 cut(s) 137, 264, 384, 571, 577, 586
HpyF3I CTNAG 1 cut(s) 600
Hsp92II CATG 2 cut(s) 91, 275
HspAI GCGC 4 cut(s) 105, 193, 267, 565
LmnI GCTCC 2 cut(s) 387, 476
Lsp1109I GCAGC 6 cut(s) 119, 143, 245, 273, 411, 561
LweI GCATC 1 cut(s) 613
MaeI CTAG 3 cut(s) 111, 128, 480
MaeIII GTNAC 2 cut(s) 121, 197
MbiI CCGCTC 2 cut(s) 244, 382
MboII GAAGA 8 cut(s) 135, 138, 141, 147, 238, 416, 562, 565
MhlI GDGCHC 1 cut(s) 48
MlsI TGGCCA 1 cut(s) 348
MluCI AATT 2 cut(s) 51, 69
MluNI TGGCCA 1 cut(s) 348
MlyI GAGTC 2 cut(s) 20, 592
Mox20I TGGCCA 1 cut(s) 348
MroXI GAANNNNTTC 1 cut(s) 209
MscI TGGCCA 1 cut(s) 348
MslI CAYNNNNRTG 1 cut(s) 92
Msp20I TGGCCA 1 cut(s) 348
MspA1I CMGCKG 6 cut(s) 83, 102, 258, 264, 574, 627
MspR9I CCNGG 5 cut(s) 162, 389, 394, 404, 618
MvaI CCWGG 5 cut(s) 162, 389, 394, 404, 618
MwoI GCNNNNNNNGC 6 cut(s) 137, 264, 384, 571, 577, 586
NlaIII CATG 2 cut(s) 91, 275
NlaIV GGNNCC 3 cut(s) 166, 515, 622
NmuCI GTSAC 2 cut(s) 121, 197
PaeR7I CTCGAG 1 cut(s) 278
PceI AGGCCT 1 cut(s) 392
PdmI GAANNNNTTC 1 cut(s) 209
PfeI GAWTC 2 cut(s) 5, 537
PleI GAGTC 2 cut(s) 20, 592
PpsI GAGTC 2 cut(s) 20, 592
PpuMI RGGWCCY 1 cut(s) 514
PshAI GACNNNNGTC 1 cut(s) 317
Psp5II RGGWCCY 1 cut(s) 514
Psp6I CCWGG 5 cut(s) 160, 387, 392, 402, 616
PspGI CCWGG 5 cut(s) 160, 387, 392, 402, 616
PspN4I GGNNCC 3 cut(s) 166, 515, 622
PspPI GGNCC 1 cut(s) 514
PspPPI RGGWCCY 1 cut(s) 514
PstI CTGCAG 2 cut(s) 263, 522
PstNI CAGNNNCTG 1 cut(s) 223
PvuII CAGCTG 2 cut(s) 83, 627
RsaI GTAC 1 cut(s) 221
RsaNI GTAC 1 cut(s) 220
RseI CAYNNNNRTG 1 cut(s) 92
Sau96I GGNCC 1 cut(s) 514
SchI GAGTC 2 cut(s) 20, 592
ScrFI CCNGG 5 cut(s) 162, 389, 394, 404, 618
SduI GDGCHC 1 cut(s) 48
SfaNI GCATC 1 cut(s) 613
SfcI CTRYAG 3 cut(s) 39, 259, 518
Sfr274I CTCGAG 1 cut(s) 278
SinI GGWCC 1 cut(s) 514
SlaI CTCGAG 1 cut(s) 278
SmiMI CAYNNNNRTG 1 cut(s) 92
SmlI CTYRAG 1 cut(s) 278
SmoI CTYRAG 1 cut(s) 278
Sse9I AATT 2 cut(s) 51, 69
SseBI AGGCCT 1 cut(s) 392
SspMI CTAG 3 cut(s) 111, 128, 480
StuI AGGCCT 1 cut(s) 392
StyD4I CCNGG 5 cut(s) 160, 387, 392, 402, 616
TaaI ACNGT 1 cut(s) 585
TaqI TCGA 3 cut(s) 279, 297, 427
TasI AATT 2 cut(s) 51, 69
TauI GCSGC 6 cut(s) 105, 177, 267, 434, 574, 580
TfiI GAWTC 2 cut(s) 5, 537
TseFI GTSAC 2 cut(s) 121, 197
TseI GCWGC 6 cut(s) 107, 131, 258, 261, 399, 574
Tsp45I GTSAC 2 cut(s) 121, 197
TspDTI ATGAA 2 cut(s) 110, 141
TspGWI ACGGA 2 cut(s) 462, 491
VpaK11BI GGWCC 1 cut(s) 514
XagI CCTNNNNNAGG 1 cut(s) 503
XhoI CTCGAG 1 cut(s) 278
XmnI GAANNNNTTC 1 cut(s) 209
XspI CTAG 3 cut(s) 111, 128, 480
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.