Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003242.1

Orthogroup ID

OG0008195

Physical Location & Seq

Genomic Coordinates Forward (+)

161987 .. 163693

Gene Structure 1707 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003242.1_g000035.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 849 bp

atggcagctccagctaaaccagaagagataagccatccaccaatggaccagcttcagggattagagtactgcattgactcaaacccatcttggggggaggcaattgctttgggttttcagcactacattttggccttgggaactgctgttatgatcccttcatttcttgttcctttgatgggtggcactgatggtgacaaagtgagagtgatacagactctgctcttcattgaaggaattaatacacttctgcagacattgtttggaacaagattgccaactgtgattggagggtcttatgcattcatggttcccattatatccattattcatgattcttcattggaaactattggcgatcctcatactagatttataaacaccatgagagcagtccaaggtgcattgatagtatcatcaagcatacagattattctgggatatagtcaaatttgggctatctgttccaggttcttcagcccacttggaatggttcctgttattgcattggtgggtttcggcatgtttgatagaggcttcccagtggtagggagatgtgttgaaattggcattccaatgctaatcctatttgtagctttctctcagtacttaaagaacttccatgcaagacagataccagtactagagcgatttgcgcttattatatcaatcacagtaatatgggcatatgcacacctcttgacagccagtggtgcttacagacaccgcccagaagctacccaattaagttgccgaactgacagggccaacctcatttcctctgctccatggttggtaccaaaactagcttcttttttttctcattggtttcacaatgctcacctttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Xan_ur_permease

Protein Analysis

282

Amino Acids

31.1

Weight (kDa)

7.15

Isoelectric Point (pI)

35.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008195)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G34190
fragaria_vesca	FvH4_3g07530 FvH4_3g07530 FvH4_3g07530
malus_domestica	MD05G1298500.v1.1 MD10G1277800.v1.1
prunus_persica	Prupe.4G064000_v2.0.a1 Prupe.4G064000_v2.0.a1
pyrus_communis	pycom05g27630 pycom10g23180
rosa_chinensis	RchiOBHm_Chr5g0011241
rosa_laevigata	RLG00000031821
rosa_multiflora	Rmu_sc0003242.1_g000035 Rmu_sc0017290.1_g000001 Rmu_sc0038215.1_g000001
rosa_roxburghii	Rroxscaffold_1G00065160
rosa_rugosa	Rorug04G0456000 Rorug04G0456100
rosa_samantha	Rh5AG088000 Rh5BG082800 Rh5CG095800 Rh5DG082700
rosa_wichuraiana	Rw5G007620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	377
Acc65I	GGTACC	1 cut(s)	796
AccB1I	GGYRCC	1 cut(s)	796
AciI	CCGC	1 cut(s)	727
AclWI	GGATC	2 cut(s)	148, 353
AcsI	RAATTY	1 cut(s)	450
AcuI	CTGAAG	2 cut(s)	38, 460
AfaI	GTAC	4 cut(s)	68, 608, 642, 798
AfiI	CCNNNNNNNGG	5 cut(s)	55, 91, 92, 179, 548
AgsI	TTSAA	2 cut(s)	233, 563
AjnI	CCWGG	1 cut(s)	467
AjuI	GAANNNNNNNTTGG	2 cut(s)	793, 825
AluBI	AGCT	6 cut(s)	8, 14, 52, 596, 737, 809
AluI	AGCT	6 cut(s)	8, 14, 52, 596, 737, 809
AlwI	GGATC	2 cut(s)	148, 353
AlwNI	CAGNNNCTG	1 cut(s)	220
AoxI	GGCC	2 cut(s)	132, 765
ApeKI	GCWGC	1 cut(s)	5
ApoI	RAATTY	1 cut(s)	450
AseI	ATTAAT	1 cut(s)	240
Asp718I	GGTACC	1 cut(s)	796
AspLEI	GCGC	1 cut(s)	658
AspS9I	GGNCC	2 cut(s)	46, 765
AsuHPI	GGTGA	2 cut(s)	206, 833
AvaII	GGWCC	1 cut(s)	46
BanI	GGYRCC	1 cut(s)	796
BbvI	GCAGC	1 cut(s)	17
BccI	CCATC	4 cut(s)	42, 94, 172, 185
BciT130I	CCWGG	1 cut(s)	469
BfaI	CTAG	3 cut(s)	369, 644, 806
BfmI	CTRYAG	1 cut(s)	251
BisI	GCNGC	1 cut(s)	6
BlsI	GCNGC	1 cut(s)	7
BmcAI	AGTACT	3 cut(s)	68, 608, 642
Bme1390I	CCNGG	1 cut(s)	469
Bme18I	GGWCC	1 cut(s)	46
BmgT120I	GGNCC	2 cut(s)	46, 765
BmiI	GGNNCC	3 cut(s)	312, 495, 798
BmrFI	CCNGG	1 cut(s)	469
BmrI	ACTGGG	1 cut(s)	536
BmuI	ACTGGG	1 cut(s)	536
BsaJI	CCNNGG	3 cut(s)	135, 397, 788
Bsc4I	CCNNNNNNNGG	5 cut(s)	55, 91, 92, 179, 548
Bse1I	ACTGG	3 cut(s)	542, 638, 708
BseBI	CCWGG	1 cut(s)	469
BseDI	CCNNGG	3 cut(s)	135, 397, 788
BseGI	GGATG	1 cut(s)	34
BseLI	CCNNNNNNNGG	5 cut(s)	55, 91, 92, 179, 548
BseMII	CTCAG	1 cut(s)	617
BseNI	ACTGG	3 cut(s)	542, 638, 708
BseXI	GCAGC	1 cut(s)	17
BshFI	GGCC	2 cut(s)	134, 767
BshNI	GGYRCC	1 cut(s)	796
BslI	CCNNNNNNNGG	5 cut(s)	55, 91, 92, 179, 548
BsmI	GAATGC	2 cut(s)	302, 570
BsnI	GGCC	2 cut(s)	134, 767
Bsp143I	GATC	2 cut(s)	153, 358
Bsp19I	CCATGG	1 cut(s)	788
BspACI	CCGC	1 cut(s)	727
BspANI	GGCC	2 cut(s)	134, 767
BspCNI	CTCAG	1 cut(s)	616
BspHI	TCATGA	1 cut(s)	331
BspLI	GGNNCC	3 cut(s)	312, 495, 798
BspMAI	CTGCAG	1 cut(s)	255
BspPI	GGATC	2 cut(s)	148, 353
BspQI	GCTCTTC	1 cut(s)	230
BspT107I	GGYRCC	1 cut(s)	796
BsrI	ACTGG	3 cut(s)	542, 638, 708
BssECI	CCNNGG	3 cut(s)	135, 397, 788
BssMI	GATC	2 cut(s)	153, 358
BssT1I	CCWWGG	3 cut(s)	135, 397, 788
Bst2UI	CCWGG	1 cut(s)	469
Bst4CI	ACNGT	2 cut(s)	283, 676
Bst6I	CTCTTC	2 cut(s)	18, 230
BstDEI	CTNAG	1 cut(s)	603
BstDSI	CCRYGG	1 cut(s)	788
BstF5I	GGATG	1 cut(s)	34
BstHHI	GCGC	1 cut(s)	658
BstKTI	GATC	2 cut(s)	156, 361
BstMBI	GATC	2 cut(s)	153, 358
BstMWI	GCNNNNNNNGC	3 cut(s)	11, 655, 713
BstNI	CCWGG	1 cut(s)	469
BstNSI	RCATGY	1 cut(s)	526
BstSCI	CCNGG	1 cut(s)	467
BstSFI	CTRYAG	1 cut(s)	251
BstV1I	GCAGC	1 cut(s)	17
BsuRI	GGCC	2 cut(s)	134, 767
BtgI	CCRYGG	1 cut(s)	788
BtsCI	GGATG	1 cut(s)	34
BtsIMutI	CAGTG	3 cut(s)	186, 549, 715
CaiI	CAGNNNCTG	1 cut(s)	220
CciI	TCATGA	1 cut(s)	331
CfoI	GCGC	1 cut(s)	658
Cfr13I	GGNCC	2 cut(s)	46, 765
Csp6I	GTAC	4 cut(s)	67, 607, 641, 797
CviAII	CATG	6 cut(s)	307, 332, 385, 523, 623, 789
CviQI	GTAC	4 cut(s)	67, 607, 641, 797
DdeI	CTNAG	1 cut(s)	603
DpnI	GATC	2 cut(s)	155, 360
DpnII	GATC	2 cut(s)	153, 358
Eam1104I	CTCTTC	2 cut(s)	18, 230
EarI	CTCTTC	2 cut(s)	18, 230
Eco130I	CCWWGG	3 cut(s)	135, 397, 788
Eco47I	GGWCC	1 cut(s)	46
Eco57I	CTGAAG	2 cut(s)	38, 460
EcoRII	CCWGG	1 cut(s)	467
EcoT14I	CCWWGG	3 cut(s)	135, 397, 788
EcoT22I	ATGCAT	1 cut(s)	304
ErhI	CCWWGG	3 cut(s)	135, 397, 788
FaeI	CATG	6 cut(s)	310, 335, 388, 526, 626, 792
FatI	CATG	6 cut(s)	306, 331, 384, 522, 622, 788
FauNDI	CATATG	1 cut(s)	688
Fnu4HI	GCNGC	1 cut(s)	6
FokI	GGATG	1 cut(s)	21
Fsp4HI	GCNGC	1 cut(s)	6
FspBI	CTAG	3 cut(s)	369, 644, 806
GlaI	GCGC	1 cut(s)	657
GluI	GCNGC	1 cut(s)	6
HaeIII	GGCC	2 cut(s)	134, 767
HhaI	GCGC	1 cut(s)	658
Hin1II	CATG	6 cut(s)	310, 335, 388, 526, 626, 792
Hin6I	GCGC	1 cut(s)	656
HinP1I	GCGC	1 cut(s)	656
HinfI	GANTC	3 cut(s)	77, 217, 335
HphI	GGTGA	2 cut(s)	206, 833
Hpy188III	TCNNGA	2 cut(s)	332, 700
HpyAV	CCTTC	2 cut(s)	168, 227
HpyCH4III	ACNGT	2 cut(s)	283, 676
HpyCH4V	TGCA	7 cut(s)	72, 253, 302, 404, 506, 626, 692
HpyF10VI	GCNNNNNNNGC	3 cut(s)	11, 655, 713
HpyF3I	CTNAG	1 cut(s)	603
Hsp92II	CATG	6 cut(s)	310, 335, 388, 526, 626, 792
HspAI	GCGC	1 cut(s)	656
KpnI	GGTACC	1 cut(s)	800
Kzo9I	GATC	2 cut(s)	153, 358
LguI	GCTCTTC	1 cut(s)	230
LmnI	GCTCC	2 cut(s)	13, 790
Lsp1109I	GCAGC	1 cut(s)	17
MaeI	CTAG	3 cut(s)	369, 644, 806
MaeIII	GTNAC	1 cut(s)	194
MalI	GATC	2 cut(s)	155, 360
MboI	GATC	2 cut(s)	153, 358
MboII	GAAGA	4 cut(s)	35, 217, 330, 466
MfeI	CAATTG	1 cut(s)	102
MluCI	AATT	5 cut(s)	102, 237, 450, 564, 743
MlyI	GAGTC	2 cut(s)	71, 211
MnlI	CCTC	7 cut(s)	91, 284, 372, 527, 707, 782, 790
Mph1103I	ATGCAT	1 cut(s)	304
MseI	TTAA	4 cut(s)	240, 611, 746, 847
MslI	CAYNNNNRTG	1 cut(s)	575
MspR9I	CCNGG	1 cut(s)	469
MunI	CAATTG	1 cut(s)	102
Mva1269I	GAATGC	2 cut(s)	302, 570
MvaI	CCWGG	1 cut(s)	469
MwoI	GCNNNNNNNGC	3 cut(s)	11, 655, 713
NcoI	CCATGG	1 cut(s)	788
NdeI	CATATG	1 cut(s)	688
NdeII	GATC	2 cut(s)	153, 358
NlaIII	CATG	6 cut(s)	310, 335, 388, 526, 626, 792
NlaIV	GGNNCC	3 cut(s)	312, 495, 798
NmuCI	GTSAC	1 cut(s)	194
NsiI	ATGCAT	1 cut(s)	304
NspI	RCATGY	1 cut(s)	526
PagI	TCATGA	1 cut(s)	331
PciSI	GCTCTTC	1 cut(s)	230
PctI	GAATGC	2 cut(s)	302, 570
PfeI	GAWTC	1 cut(s)	335
PkrI	GCNGC	1 cut(s)	7
PleI	GAGTC	2 cut(s)	71, 211
PpsI	GAGTC	2 cut(s)	71, 211
PshBI	ATTAAT	1 cut(s)	240
PsiI	TTATAA	1 cut(s)	377
Psp6I	CCWGG	1 cut(s)	467
PspGI	CCWGG	1 cut(s)	467
PspN4I	GGNNCC	3 cut(s)	312, 495, 798
PspPI	GGNCC	2 cut(s)	46, 765
PstI	CTGCAG	1 cut(s)	255
PstNI	CAGNNNCTG	1 cut(s)	220
RsaI	GTAC	4 cut(s)	68, 608, 642, 798
RsaNI	GTAC	4 cut(s)	67, 607, 641, 797
RseI	CAYNNNNRTG	1 cut(s)	575
SapI	GCTCTTC	1 cut(s)	230
SaqAI	TTAA	4 cut(s)	240, 611, 746, 847
SatI	GCNGC	1 cut(s)	6
Sau3AI	GATC	2 cut(s)	153, 358
Sau96I	GGNCC	2 cut(s)	46, 765
ScaI	AGTACT	3 cut(s)	68, 608, 642
SchI	GAGTC	2 cut(s)	71, 211
ScrFI	CCNGG	1 cut(s)	469
SfcI	CTRYAG	1 cut(s)	251
SinI	GGWCC	1 cut(s)	46
SmiMI	CAYNNNNRTG	1 cut(s)	575
Sse9I	AATT	5 cut(s)	102, 237, 450, 564, 743
SsiI	CCGC	1 cut(s)	727
SspMI	CTAG	3 cut(s)	369, 644, 806
StyD4I	CCNGG	1 cut(s)	467
StyI	CCWWGG	3 cut(s)	135, 397, 788
TaaI	ACNGT	2 cut(s)	283, 676
TasI	AATT	5 cut(s)	102, 237, 450, 564, 743
TatI	WGTACW	3 cut(s)	66, 606, 640
TfiI	GAWTC	1 cut(s)	335
Tru1I	TTAA	4 cut(s)	240, 611, 746, 847
Tru9I	TTAA	4 cut(s)	240, 611, 746, 847
TscAI	CASTG	3 cut(s)	193, 549, 715
TseFI	GTSAC	1 cut(s)	194
TseI	GCWGC	1 cut(s)	5
Tsp45I	GTSAC	1 cut(s)	194
TspDTI	ATGAA	5 cut(s)	150, 217, 295, 320, 330
TspRI	CASTG	3 cut(s)	193, 549, 715
VpaK11BI	GGWCC	1 cut(s)	46
VspI	ATTAAT	1 cut(s)	240
XapI	RAATTY	1 cut(s)	450
XceI	RCATGY	1 cut(s)	526
XspI	CTAG	3 cut(s)	369, 644, 806
ZrmI	AGTACT	3 cut(s)	68, 608, 642
Zsp2I	ATGCAT	1 cut(s)	304

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.