Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0038215.1

Orthogroup ID

OG0008195

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 556

Gene Structure 556 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0038215.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 303 bp

gtagggagatgtgttgaaattggcattccaatgctaatcctatttgtagctttctctcagtacttaaagaacttccatgcaagacagataccagtactagagcgatttgcgcttattatatcaatcacagtaatatgggcatatgcacacctcttgacagccagtggtgcttacagacaccgcccagaagctacccaattaagttgccgaactgacagggccaacctcatttcctctgctccatggttggtaccaaaactagcttcttttttttctcattggtttcacaatgctcacctttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Xan_ur_permease

Protein Analysis

100

Amino Acids

11.42

Weight (kDa)

9.89

Isoelectric Point (pI)

24.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008195)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G34190
fragaria_vesca	FvH4_3g07530 FvH4_3g07530 FvH4_3g07530
malus_domestica	MD05G1298500.v1.1 MD10G1277800.v1.1
prunus_persica	Prupe.4G064000_v2.0.a1 Prupe.4G064000_v2.0.a1
pyrus_communis	pycom05g27630 pycom10g23180
rosa_chinensis	RchiOBHm_Chr5g0011241
rosa_laevigata	RLG00000031821
rosa_multiflora	Rmu_sc0003242.1_g000035 Rmu_sc0017290.1_g000001 Rmu_sc0038215.1_g000001
rosa_roxburghii	Rroxscaffold_1G00065160
rosa_rugosa	Rorug04G0456000 Rorug04G0456100
rosa_samantha	Rh5AG088000 Rh5BG082800 Rh5CG095800 Rh5DG082700
rosa_wichuraiana	Rw5G007620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	250
AccB1I	GGYRCC	1 cut(s)	250
AciI	CCGC	1 cut(s)	181
AfaI	GTAC	3 cut(s)	62, 96, 252
AgsI	TTSAA	1 cut(s)	17
AjuI	GAANNNNNNNTTGG	2 cut(s)	247, 279
AluBI	AGCT	3 cut(s)	50, 191, 263
AluI	AGCT	3 cut(s)	50, 191, 263
AoxI	GGCC	1 cut(s)	219
Asp718I	GGTACC	1 cut(s)	250
AspLEI	GCGC	1 cut(s)	112
AspS9I	GGNCC	1 cut(s)	219
AsuHPI	GGTGA	1 cut(s)	287
BanI	GGYRCC	1 cut(s)	250
BfaI	CTAG	2 cut(s)	98, 260
BmcAI	AGTACT	2 cut(s)	62, 96
BmgT120I	GGNCC	1 cut(s)	219
BmiI	GGNNCC	1 cut(s)	252
BsaJI	CCNNGG	1 cut(s)	242
Bse1I	ACTGG	2 cut(s)	92, 162
BseDI	CCNNGG	1 cut(s)	242
BseMII	CTCAG	1 cut(s)	71
BseNI	ACTGG	2 cut(s)	92, 162
BshFI	GGCC	1 cut(s)	221
BshNI	GGYRCC	1 cut(s)	250
BsmI	GAATGC	1 cut(s)	24
BsnI	GGCC	1 cut(s)	221
Bsp19I	CCATGG	1 cut(s)	242
BspACI	CCGC	1 cut(s)	181
BspANI	GGCC	1 cut(s)	221
BspCNI	CTCAG	1 cut(s)	70
BspLI	GGNNCC	1 cut(s)	252
BspT107I	GGYRCC	1 cut(s)	250
BsrI	ACTGG	2 cut(s)	92, 162
BssECI	CCNNGG	1 cut(s)	242
BssT1I	CCWWGG	1 cut(s)	242
Bst4CI	ACNGT	1 cut(s)	130
BstDEI	CTNAG	1 cut(s)	57
BstDSI	CCRYGG	1 cut(s)	242
BstHHI	GCGC	1 cut(s)	112
BstMWI	GCNNNNNNNGC	2 cut(s)	109, 167
BsuRI	GGCC	1 cut(s)	221
BtgI	CCRYGG	1 cut(s)	242
BtsIMutI	CAGTG	1 cut(s)	169
CfoI	GCGC	1 cut(s)	112
Cfr13I	GGNCC	1 cut(s)	219
Csp6I	GTAC	3 cut(s)	61, 95, 251
CviAII	CATG	2 cut(s)	77, 243
CviJI	RGCY	5 cut(s)	50, 161, 191, 221, 263
CviKI_1	RGCY	5 cut(s)	50, 161, 191, 221, 263
CviQI	GTAC	3 cut(s)	61, 95, 251
DdeI	CTNAG	1 cut(s)	57
Eco130I	CCWWGG	1 cut(s)	242
EcoT14I	CCWWGG	1 cut(s)	242
ErhI	CCWWGG	1 cut(s)	242
FaeI	CATG	2 cut(s)	80, 246
FaiI	YATR	6 cut(s)	78, 119, 136, 142, 144, 244
FatI	CATG	2 cut(s)	76, 242
FauNDI	CATATG	1 cut(s)	142
FspBI	CTAG	2 cut(s)	98, 260
GlaI	GCGC	1 cut(s)	111
HaeIII	GGCC	1 cut(s)	221
HhaI	GCGC	1 cut(s)	112
Hin1II	CATG	2 cut(s)	80, 246
Hin6I	GCGC	1 cut(s)	110
HinP1I	GCGC	1 cut(s)	110
HphI	GGTGA	1 cut(s)	287
Hpy188III	TCNNGA	1 cut(s)	154
HpyCH4III	ACNGT	1 cut(s)	130
HpyCH4V	TGCA	2 cut(s)	80, 146
HpyF10VI	GCNNNNNNNGC	2 cut(s)	109, 167
HpyF3I	CTNAG	1 cut(s)	57
Hsp92II	CATG	2 cut(s)	80, 246
HspAI	GCGC	1 cut(s)	110
KpnI	GGTACC	1 cut(s)	254
LmnI	GCTCC	1 cut(s)	244
LpnPI	CCDG	4 cut(s)	105, 175, 198, 202
MaeI	CTAG	2 cut(s)	98, 260
MluCI	AATT	2 cut(s)	18, 197
MnlI	CCTC	3 cut(s)	161, 236, 244
MseI	TTAA	3 cut(s)	65, 200, 301
MslI	CAYNNNNRTG	1 cut(s)	29
Mva1269I	GAATGC	1 cut(s)	24
MwoI	GCNNNNNNNGC	2 cut(s)	109, 167
NcoI	CCATGG	1 cut(s)	242
NdeI	CATATG	1 cut(s)	142
NlaIII	CATG	2 cut(s)	80, 246
NlaIV	GGNNCC	1 cut(s)	252
PctI	GAATGC	1 cut(s)	24
PspN4I	GGNNCC	1 cut(s)	252
PspPI	GGNCC	1 cut(s)	219
RsaI	GTAC	3 cut(s)	62, 96, 252
RsaNI	GTAC	3 cut(s)	61, 95, 251
RseI	CAYNNNNRTG	1 cut(s)	29
SaqAI	TTAA	3 cut(s)	65, 200, 301
Sau96I	GGNCC	1 cut(s)	219
ScaI	AGTACT	2 cut(s)	62, 96
SetI	ASST	6 cut(s)	52, 153, 193, 228, 265, 300
SmiMI	CAYNNNNRTG	1 cut(s)	29
Sse9I	AATT	2 cut(s)	18, 197
SsiI	CCGC	1 cut(s)	181
SspMI	CTAG	2 cut(s)	98, 260
StyI	CCWWGG	1 cut(s)	242
TaaI	ACNGT	1 cut(s)	130
TasI	AATT	2 cut(s)	18, 197
TatI	WGTACW	2 cut(s)	60, 94
Tru1I	TTAA	3 cut(s)	65, 200, 301
Tru9I	TTAA	3 cut(s)	65, 200, 301
TscAI	CASTG	1 cut(s)	169
TspRI	CASTG	1 cut(s)	169
XspI	CTAG	2 cut(s)	98, 260
ZrmI	AGTACT	2 cut(s)	62, 96

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.