Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003660.1

Orthogroup ID

OG0018176

Physical Location & Seq

Genomic Coordinates Forward (+)

6654 .. 7782

Gene Structure 1129 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003660.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 498 bp

atgcctagcagagatgttcatgatagcattgttcgttggacttgtttggttactaagtactcgagaggtggttgggtcgatgaggctcgggtgctgtttgatatcatgccggagagaaatgtggtaacttataatgctatgttgttcgggtatgtgcagtcagggaggcttgggacacttgataactgtggtgggaaatggagtgctcttgtggattgtttaactttgaagacgaagcggtcagctgaagtgcagggccggtatgctttgtttcggaaaatgcctgagaggaacgttgtttcttggacagccatgattggtggctttgcttggaatggattttatagagaagctctattgttattccttgaatggaatgggaactatgaaacaagaccaaatggagagacgttcatatcgcttgtatatgcttgtgctggtatttggttgcctcatcttggaaagcaactacatgctcagttgattgtcagcaattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR

Protein Analysis

165

Amino Acids

18.8

Weight (kDa)

8.96

Isoelectric Point (pI)

42.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018176)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0411551 RchiOBHm_Chr7g0229601
rosa_laevigata	RLG00000008199 RLG00000008346
rosa_multiflora	Rmu_sc0003660.1_g000002 Rmu_sc0007538.1_g000014 Rmu_ssc0000281.1_g000012
rosa_rugosa	Rorug07G0192000
rosa_samantha	Rh4BG165600 Rh5AG246500 Rh5CG244600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	132
AasI	GACNNNNNNGTC	1 cut(s)	238
AciI	CCGC	1 cut(s)	238
AclI	AACGTT	1 cut(s)	294
AcuI	CTGAAG	1 cut(s)	267
AfaI	GTAC	1 cut(s)	59
AfiI	CCNNNNNNNGG	1 cut(s)	458
AgsI	TTSAA	2 cut(s)	229, 371
AluBI	AGCT	2 cut(s)	245, 353
AluI	AGCT	2 cut(s)	245, 353
Alw21I	GWGCWC	1 cut(s)	208
Alw26I	GTCTC	1 cut(s)	401
Ama87I	CYCGRG	2 cut(s)	61, 87
AoxI	GGCC	1 cut(s)	256
AspS9I	GGNCC	1 cut(s)	256
AvaI	CYCGRG	2 cut(s)	61, 87
BbsI	GAAGAC	1 cut(s)	236
Bbv12I	GWGCWC	1 cut(s)	208
BcoDI	GTCTC	1 cut(s)	401
BfaI	CTAG	1 cut(s)	6
BmcAI	AGTACT	1 cut(s)	59
BmeT110I	CYCGRG	2 cut(s)	61, 87
BmgT120I	GGNCC	1 cut(s)	256
BpiI	GAAGAC	1 cut(s)	236
Bsc4I	CCNNNNNNNGG	1 cut(s)	458
Bse118I	RCCGGY	1 cut(s)	258
BseLI	CCNNNNNNNGG	1 cut(s)	458
BseMII	CTCAG	2 cut(s)	276, 491
BsgI	GTGCAG	2 cut(s)	176, 272
BshFI	GGCC	1 cut(s)	258
BsiHKAI	GWGCWC	1 cut(s)	208
BsiHKCI	CYCGRG	2 cut(s)	61, 87
BsiSI	CCGG	2 cut(s)	110, 259
BslFI	GGGAC	1 cut(s)	187
BslI	CCNNNNNNNGG	1 cut(s)	458
BsmAI	GTCTC	1 cut(s)	401
BsmBI	CGTCTC	1 cut(s)	401
BsmFI	GGGAC	1 cut(s)	187
BsnI	GGCC	1 cut(s)	258
BsoBI	CYCGRG	2 cut(s)	61, 87
Bsp1286I	GDGCHC	1 cut(s)	208
BspACI	CCGC	1 cut(s)	238
BspANI	GGCC	1 cut(s)	258
BspCNI	CTCAG	2 cut(s)	277, 490
BspHI	TCATGA	1 cut(s)	19
BsrFI	RCCGGY	1 cut(s)	258
BssAI	RCCGGY	1 cut(s)	258
Bst4CI	ACNGT	1 cut(s)	188
BstDEI	CTNAG	3 cut(s)	54, 285, 477
BstMAI	GTCTC	1 cut(s)	401
BstNSI	RCATGY	1 cut(s)	476
BstV2I	GAAGAC	1 cut(s)	236
BsuRI	GGCC	1 cut(s)	258
CciI	TCATGA	1 cut(s)	19
Cfr10I	RCCGGY	1 cut(s)	258
Cfr13I	GGNCC	1 cut(s)	256
Csp6I	GTAC	1 cut(s)	58
CviAII	CATG	4 cut(s)	20, 106, 313, 473
CviJI	RGCY	7 cut(s)	86, 169, 245, 258, 311, 324, 353
CviKI_1	RGCY	7 cut(s)	86, 169, 245, 258, 311, 324, 353
CviQI	GTAC	1 cut(s)	58
DdeI	CTNAG	3 cut(s)	54, 285, 477
DrdI	GACNNNNNNGTC	1 cut(s)	238
DseDI	GACNNNNNNGTC	1 cut(s)	238
Eco32I	GATATC	1 cut(s)	103
Eco57I	CTGAAG	1 cut(s)	267
Eco88I	CYCGRG	2 cut(s)	61, 87
EcoRV	GATATC	1 cut(s)	103
Esp3I	CGTCTC	1 cut(s)	401
FaeI	CATG	4 cut(s)	23, 109, 316, 476
FaqI	GGGAC	1 cut(s)	187
FatI	CATG	4 cut(s)	19, 105, 312, 472
FspBI	CTAG	1 cut(s)	6
HaeIII	GGCC	1 cut(s)	258
HapII	CCGG	2 cut(s)	110, 259
Hin1II	CATG	4 cut(s)	23, 109, 316, 476
HpaII	CCGG	2 cut(s)	110, 259
Hpy188I	TCNGA	1 cut(s)	276
Hpy188III	TCNNGA	2 cut(s)	20, 63
HpyCH4III	ACNGT	1 cut(s)	188
HpyCH4IV	ACGT	2 cut(s)	294, 410
HpyCH4V	TGCA	2 cut(s)	157, 253
HpyF3I	CTNAG	3 cut(s)	54, 285, 477
HpySE526I	ACGT	2 cut(s)	294, 410
Hsp92II	CATG	4 cut(s)	23, 109, 316, 476
LpnPI	CCDG	6 cut(s)	123, 147, 239, 272, 297, 423
MaeI	CTAG	1 cut(s)	6
MaeII	ACGT	2 cut(s)	294, 410
MaeIII	GTNAC	2 cut(s)	49, 124
MboII	GAAGA	1 cut(s)	241
MhlI	GDGCHC	1 cut(s)	208
MluCI	AATT	1 cut(s)	493
MmeI	TCCRAC	1 cut(s)	17
MnlI	CCTC	5 cut(s)	59, 76, 159, 282, 462
MseI	TTAA	1 cut(s)	221
MspA1I	CMGCKG	1 cut(s)	245
MspI	CCGG	2 cut(s)	110, 259
NlaIII	CATG	4 cut(s)	23, 109, 316, 476
NspI	RCATGY	1 cut(s)	476
PaeR7I	CTCGAG	1 cut(s)	61
PagI	TCATGA	1 cut(s)	19
PsiI	TTATAA	1 cut(s)	132
Psp1406I	AACGTT	1 cut(s)	294
PspPI	GGNCC	1 cut(s)	256
PvuII	CAGCTG	1 cut(s)	245
RsaI	GTAC	1 cut(s)	59
RsaNI	GTAC	1 cut(s)	58
SaqAI	TTAA	1 cut(s)	221
Sau96I	GGNCC	1 cut(s)	256
ScaI	AGTACT	1 cut(s)	59
SduI	GDGCHC	1 cut(s)	208
SetI	ASST	5 cut(s)	70, 247, 297, 355, 413
Sfr274I	CTCGAG	1 cut(s)	61
SlaI	CTCGAG	1 cut(s)	61
SmlI	CTYRAG	1 cut(s)	61
SmoI	CTYRAG	1 cut(s)	61
Sse9I	AATT	1 cut(s)	493
SsiI	CCGC	1 cut(s)	238
SspMI	CTAG	1 cut(s)	6
TaaI	ACNGT	1 cut(s)	188
TaiI	ACGT	2 cut(s)	297, 413
TaqI	TCGA	2 cut(s)	62, 78
TasI	AATT	1 cut(s)	493
TatI	WGTACW	1 cut(s)	57
Tru1I	TTAA	1 cut(s)	221
Tru9I	TTAA	1 cut(s)	221
TspDTI	ATGAA	3 cut(s)	8, 402, 403
XceI	RCATGY	1 cut(s)	476
XhoI	CTCGAG	1 cut(s)	61
XspI	CTAG	1 cut(s)	6
ZrmI	AGTACT	1 cut(s)	59

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.