Rmu_sc0007538.1_g000014

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007538.1
Physical Location & Seq
Forward (+)
81004 .. 81336
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007538.1_g000014.1.cds

Sequence Viewer

Length: 333 bp
atgtttaaagatgcacgccacctgcttgagaaaatgcctagcagagatgttcatgatagcattgttcattggacttgtttggttactaagtactcgagaggtggttgggtcgatgaggctcgggtgctgtttgatatcatgccagagaaaaatgtggtaacttataatgttatgttgttcgagtatgtgcagtcagggaggttgagtgagggttgtcagtttttttatgagatgctggagaggaatgtggtgtcatggacttcgatgctgtgtgggttagcttgtgcggggaggattgaggaggcgaggcggttgtttgaggaaatgccatag

Protein Analysis

110

Amino Acids

12.93

Weight (kDa)

5.59

Isoelectric Point (pI)

57.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 165
AarI CACCTGC 1 cut(s) 30
Acc36I ACCTGC 1 cut(s) 30
AciI CCGC 2 cut(s) 287, 310
AfaI GTAC 1 cut(s) 92
AluBI AGCT 1 cut(s) 281
AluI AGCT 1 cut(s) 281
Ama87I CYCGRG 2 cut(s) 94, 120
AvaI CYCGRG 2 cut(s) 94, 120
BfaI CTAG 1 cut(s) 39
BfuAI ACCTGC 1 cut(s) 30
BmcAI AGTACT 1 cut(s) 92
BmeT110I CYCGRG 2 cut(s) 94, 120
BmsI GCATC 2 cut(s) 222, 255
BpmI CTGGAG 1 cut(s) 257
BpuEI CTTGAG 1 cut(s) 47
BsaXI ACNNNNNCTCC 2 cut(s) 190, 220
BseRI GAGGAG 1 cut(s) 314
BsgI GTGCAG 1 cut(s) 209
BsiHKCI CYCGRG 2 cut(s) 94, 120
BsoBI CYCGRG 2 cut(s) 94, 120
BspACI CCGC 2 cut(s) 287, 310
BspHI TCATGA 1 cut(s) 52
BspMI ACCTGC 1 cut(s) 30
BstC8I GCNNGC 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 87
BveI ACCTGC 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 16
CciI TCATGA 1 cut(s) 52
Csp6I GTAC 1 cut(s) 91
CviAII CATG 3 cut(s) 53, 139, 255
CviJI RGCY 2 cut(s) 119, 281
CviKI_1 RGCY 2 cut(s) 119, 281
CviQI GTAC 1 cut(s) 91
DdeI CTNAG 1 cut(s) 87
DraI TTTAAA 1 cut(s) 7
Eco32I GATATC 1 cut(s) 136
Eco88I CYCGRG 2 cut(s) 94, 120
EcoRV GATATC 1 cut(s) 136
FaeI CATG 3 cut(s) 56, 142, 258
FaiI YATR 8 cut(s) 54, 140, 165, 173, 186, 228, 256, 331
FatI CATG 3 cut(s) 52, 138, 254
FauI CCCGC 1 cut(s) 280
FspBI CTAG 1 cut(s) 39
GsuI CTGGAG 1 cut(s) 257
Hin1II CATG 3 cut(s) 56, 142, 258
Hpy188III TCNNGA 2 cut(s) 53, 96
HpyCH4V TGCA 2 cut(s) 14, 190
HpyF3I CTNAG 1 cut(s) 87
Hsp92II CATG 3 cut(s) 56, 142, 258
LpnPI CCDG 4 cut(s) 35, 156, 180, 221
LweI GCATC 2 cut(s) 222, 255
MaeI CTAG 1 cut(s) 39
MaeIII GTNAC 2 cut(s) 82, 157
MseI TTAA 1 cut(s) 6
NlaIII CATG 3 cut(s) 56, 142, 258
PaeR7I CTCGAG 1 cut(s) 94
PagI TCATGA 1 cut(s) 52
PaqCI CACCTGC 1 cut(s) 30
PsiI TTATAA 1 cut(s) 165
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
SaqAI TTAA 1 cut(s) 6
ScaI AGTACT 1 cut(s) 92
SetI ASST 4 cut(s) 24, 103, 203, 283
SfaNI GCATC 2 cut(s) 222, 255
Sfr274I CTCGAG 1 cut(s) 94
SlaI CTCGAG 1 cut(s) 94
SmlI CTYRAG 2 cut(s) 26, 94
SmoI CTYRAG 2 cut(s) 26, 94
SsiI CCGC 2 cut(s) 287, 310
SspMI CTAG 1 cut(s) 39
TaqI TCGA 4 cut(s) 95, 111, 180, 263
TatI WGTACW 1 cut(s) 90
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TspDTI ATGAA 2 cut(s) 41, 56
XhoI CTCGAG 1 cut(s) 94
XspI CTAG 1 cut(s) 39
ZrmI AGTACT 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.