Rmu_sc0003681.1_g000001

Belongs to the Ca(2 ) cation antiporter (CaCA) (TC 2.A.19) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003681.1
OG0012596
Physical Location & Seq
Forward (+)
1 .. 1550
1550 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003681.1_g000001.1.cds

Sequence Viewer

Length: 828 bp
gtcttccggccctgggtccaaaaaagaagattagaatttgtgaaacatgggcatttggtatcaaacattttacaacatgtgcaaaaacatgcgctagggagaatcctcactgtccaaggagcacctaatttacgtgccataagaaggctatttgaggaaatggatgaagatggtgacaatcatatatccattcctgaagtaaaaaaacttcttcaggaaatcaaattcacatcattggaaaatgatgaggacataggaatagcagaagtgatgaaaaagtttgacatcgatcatgatggaaaaattaataaagatgaattcatgaatggcttcacaaaatggcttgatgagtacaagtcagtacataaagaaaataccgaaagatcgttggaggacatataccaggtttttcaaccttggattcaaaatagaagaaaagaacgcgaaatgaagaagaatttgatgtcagaagtactaagacacgtccaaagcaattcacttggagccattatcacagaaaatggcatgcctcatacggaaaatattagaagcttgtttgaacagattgatcttgatggaaataataatatatcagaagcagaactaagagaactgatcatgaacatcaagtctggtaacattccactcgaagttgatgaatcagttaacaaattggtagaagaacttgacacaagtggagaccatttgattaatgaggaggaattcgttactggattaacaaaatggatgaataaatcccatgatacccaaactctttcgtcattagagtcggaggacgatctctaccaagtaagtatacttaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EF-hand_7 EF-hand_8 Na_Ca_ex

Protein Analysis

275

Amino Acids

32.06

Weight (kDa)

5.11

Isoelectric Point (pI)

56.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 817
AccII CGCG 1 cut(s) 444
AcsI RAATTY 5 cut(s) 35, 224, 317, 457, 722
AcuI CTGAAG 2 cut(s) 197, 216
AfaI GTAC 3 cut(s) 353, 363, 474
AfiI CCNNNNNNNGG 2 cut(s) 13, 144
AflIII ACRYGT 2 cut(s) 76, 481
AgsI TTSAA 3 cut(s) 413, 425, 560
AjiI CACGTC 1 cut(s) 484
AjnI CCWGG 2 cut(s) 11, 402
AluBI AGCT 1 cut(s) 552
AluI AGCT 1 cut(s) 552
Alw21I GWGCWC 1 cut(s) 124
Alw26I GTCTC 1 cut(s) 693
AoxI GGCC 1 cut(s) 8
ApoI RAATTY 5 cut(s) 35, 224, 317, 457, 722
AseI ATTAAT 2 cut(s) 306, 711
Asp700I GAANNNNTTC 1 cut(s) 329
AspLEI GCGC 1 cut(s) 94
AspS9I GGNCC 2 cut(s) 9, 16
AsuHPI GGTGA 1 cut(s) 185
AvaII GGWCC 1 cut(s) 16
BarI GAAGNNNNNNTAC 2 cut(s) 192, 224
Bbv12I GWGCWC 1 cut(s) 124
BccI CCATC 3 cut(s) 164, 290, 569
BciT130I CCWGG 2 cut(s) 13, 404
BclI TGATCA 1 cut(s) 615
BcoDI GTCTC 1 cut(s) 693
BfaI CTAG 1 cut(s) 95
BmcAI AGTACT 1 cut(s) 474
Bme1390I CCNGG 2 cut(s) 13, 404
Bme18I GGWCC 1 cut(s) 16
BmgBI CACGTC 1 cut(s) 484
BmgT120I GGNCC 2 cut(s) 9, 16
BmiI GGNNCC 2 cut(s) 17, 505
BmrFI CCNGG 2 cut(s) 13, 404
Bsa29I ATCGAT 1 cut(s) 288
BsaAI YACGTR 1 cut(s) 134
BsaI GGTCTC 1 cut(s) 693
BsaJI CCNNGG 4 cut(s) 11, 12, 115, 416
Bsc4I CCNNNNNNNGG 2 cut(s) 13, 144
Bse1I ACTGG 1 cut(s) 736
BseBI CCWGG 2 cut(s) 13, 404
BseCI ATCGAT 1 cut(s) 288
BseDI CCNNGG 4 cut(s) 11, 12, 115, 416
BseGI GGATG 2 cut(s) 169, 753
BseLI CCNNNNNNNGG 2 cut(s) 13, 144
BseNI ACTGG 1 cut(s) 736
BseRI GAGGAG 1 cut(s) 731
Bsh1236I CGCG 1 cut(s) 444
BshFI GGCC 1 cut(s) 10
BshVI ATCGAT 1 cut(s) 288
BsiHKAI GWGCWC 1 cut(s) 124
BsiSI CCGG 1 cut(s) 7
BslI CCNNNNNNNGG 2 cut(s) 13, 144
BsmAI GTCTC 1 cut(s) 693
BsnI GGCC 1 cut(s) 10
Bso31I GGTCTC 1 cut(s) 693
Bsp1286I GDGCHC 1 cut(s) 124
Bsp143I GATC 5 cut(s) 289, 383, 568, 615, 799
BspANI GGCC 1 cut(s) 10
BspDI ATCGAT 1 cut(s) 288
BspFNI CGCG 1 cut(s) 444
BspHI TCATGA 3 cut(s) 292, 321, 618
BspLI GGNNCC 2 cut(s) 17, 505
BspTNI GGTCTC 1 cut(s) 693
BsrI ACTGG 1 cut(s) 736
BssECI CCNNGG 4 cut(s) 11, 12, 115, 416
BssMI GATC 5 cut(s) 289, 383, 568, 615, 799
BssNAI GTATAC 1 cut(s) 818
BssT1I CCWWGG 2 cut(s) 115, 416
Bst1107I GTATAC 1 cut(s) 818
Bst2UI CCWGG 2 cut(s) 13, 404
Bst4CI ACNGT 1 cut(s) 112
BstBAI YACGTR 1 cut(s) 134
BstC8I GCNNGC 1 cut(s) 527
BstDEI CTNAG 2 cut(s) 476, 605
BstF5I GGATG 2 cut(s) 169, 753
BstFNI CGCG 1 cut(s) 444
BstHHI GCGC 1 cut(s) 94
BstKTI GATC 5 cut(s) 292, 386, 571, 618, 802
BstMAI GTCTC 1 cut(s) 693
BstMBI GATC 5 cut(s) 289, 383, 568, 615, 799
BstNI CCWGG 2 cut(s) 13, 404
BstNSI RCATGY 3 cut(s) 80, 92, 529
BstSCI CCNGG 2 cut(s) 11, 402
BstUI CGCG 1 cut(s) 444
BstZ17I GTATAC 1 cut(s) 818
Bsu15I ATCGAT 1 cut(s) 288
BsuRI GGCC 1 cut(s) 10
BsuTUI ATCGAT 1 cut(s) 288
BtrI CACGTC 1 cut(s) 484
BtsCI GGATG 2 cut(s) 169, 753
BtsIMutI CAGTG 1 cut(s) 108
Cac8I GCNNGC 1 cut(s) 527
CciI TCATGA 3 cut(s) 292, 321, 618
CfoI GCGC 1 cut(s) 94
Cfr13I GGNCC 2 cut(s) 9, 16
ClaI ATCGAT 1 cut(s) 288
CsiI ACCWGGT 1 cut(s) 402
Csp6I GTAC 3 cut(s) 352, 362, 473
CviAII CATG 8 cut(s) 47, 77, 89, 293, 322, 526, 619, 761
CviJI RGCY 6 cut(s) 10, 148, 330, 343, 506, 552
CviKI_1 RGCY 6 cut(s) 10, 148, 330, 343, 506, 552
CviQI GTAC 3 cut(s) 352, 362, 473
DdeI CTNAG 2 cut(s) 476, 605
DpnI GATC 5 cut(s) 291, 385, 570, 617, 801
DpnII GATC 5 cut(s) 289, 383, 568, 615, 799
Eco130I CCWWGG 2 cut(s) 115, 416
Eco31I GGTCTC 1 cut(s) 693
Eco47I GGWCC 1 cut(s) 16
Eco57I CTGAAG 2 cut(s) 197, 216
EcoRI GAATTC 2 cut(s) 317, 722
EcoRII CCWGG 2 cut(s) 11, 402
EcoT14I CCWWGG 2 cut(s) 115, 416
ErhI CCWWGG 2 cut(s) 115, 416
FaeI CATG 8 cut(s) 50, 80, 92, 296, 325, 529, 622, 764
FatI CATG 8 cut(s) 46, 76, 88, 292, 321, 525, 618, 760
FbaI TGATCA 1 cut(s) 615
FblI GTMKAC 1 cut(s) 817
FokI GGATG 2 cut(s) 176, 760
FspBI CTAG 1 cut(s) 95
GlaI GCGC 1 cut(s) 93
HaeIII GGCC 1 cut(s) 10
HapII CCGG 1 cut(s) 7
HhaI GCGC 1 cut(s) 94
Hin1II CATG 8 cut(s) 50, 80, 92, 296, 325, 529, 622, 764
Hin6I GCGC 1 cut(s) 92
HinP1I GCGC 1 cut(s) 92
HincII GTYRAC 1 cut(s) 667
HindII GTYRAC 1 cut(s) 667
HindIII AAGCTT 1 cut(s) 550
HinfI GANTC 4 cut(s) 102, 421, 659, 788
HpaI GTTAAC 1 cut(s) 667
HpaII CCGG 1 cut(s) 7
HphI GGTGA 1 cut(s) 185
Hpy166II GTNNAC 2 cut(s) 667, 818
Hpy188I TCNGA 3 cut(s) 469, 595, 793
Hpy188III TCNNGA 6 cut(s) 194, 215, 293, 322, 572, 619
Hpy8I GTNNAC 2 cut(s) 667, 818
HpyAV CCTTC 1 cut(s) 138
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4IV ACGT 2 cut(s) 133, 483
HpyCH4V TGCA 1 cut(s) 82
HpyF3I CTNAG 2 cut(s) 476, 605
HpySE526I ACGT 2 cut(s) 133, 483
Hsp92II CATG 8 cut(s) 50, 80, 92, 296, 325, 529, 622, 764
HspAI GCGC 1 cut(s) 92
Ksp22I TGATCA 1 cut(s) 615
KspAI GTTAAC 1 cut(s) 667
Kzo9I GATC 5 cut(s) 289, 383, 568, 615, 799
LmnI GCTCC 2 cut(s) 119, 503
LpnPI CCDG 8 cut(s) 20, 25, 200, 207, 389, 416, 618, 717
MabI ACCWGGT 1 cut(s) 402
MaeI CTAG 1 cut(s) 95
MaeII ACGT 2 cut(s) 133, 483
MaeIII GTNAC 3 cut(s) 173, 635, 727
MalI GATC 5 cut(s) 291, 385, 570, 617, 801
MboI GATC 5 cut(s) 289, 383, 568, 615, 799
MboII GAAGA 7 cut(s) 39, 179, 203, 444, 463, 466, 692
MhlI GDGCHC 1 cut(s) 124
MlyI GAGTC 1 cut(s) 797
MmeI TCCRAC 2 cut(s) 369, 771
MnlI CCTC 8 cut(s) 116, 148, 241, 385, 540, 709, 712, 787
MroXI GAANNNNTTC 1 cut(s) 329
MseI TTAA 5 cut(s) 306, 666, 711, 737, 822
MspI CCGG 1 cut(s) 7
MspR9I CCNGG 2 cut(s) 13, 404
MvaI CCWGG 2 cut(s) 13, 404
MvnI CGCG 1 cut(s) 444
NdeII GATC 5 cut(s) 289, 383, 568, 615, 799
NlaIII CATG 8 cut(s) 50, 80, 92, 296, 325, 529, 622, 764
NlaIV GGNNCC 2 cut(s) 17, 505
NmuCI GTSAC 1 cut(s) 173
NspI RCATGY 3 cut(s) 80, 92, 529
PaeI GCATGC 1 cut(s) 529
PagI TCATGA 3 cut(s) 292, 321, 618
PasI CCCWGGG 1 cut(s) 12
PciI ACATGT 1 cut(s) 76
PdmI GAANNNNTTC 1 cut(s) 329
PfeI GAWTC 3 cut(s) 102, 421, 659
PleI GAGTC 1 cut(s) 796
PpsI GAGTC 1 cut(s) 796
Ppu21I YACGTR 1 cut(s) 134
PscI ACATGT 1 cut(s) 76
PshBI ATTAAT 2 cut(s) 306, 711
Psp6I CCWGG 2 cut(s) 11, 402
PspGI CCWGG 2 cut(s) 11, 402
PspN4I GGNNCC 2 cut(s) 17, 505
PspPI GGNCC 2 cut(s) 9, 16
RsaI GTAC 3 cut(s) 353, 363, 474
RsaNI GTAC 3 cut(s) 352, 362, 473
SaqAI TTAA 5 cut(s) 306, 666, 711, 737, 822
Sau3AI GATC 5 cut(s) 289, 383, 568, 615, 799
Sau96I GGNCC 2 cut(s) 9, 16
ScaI AGTACT 1 cut(s) 474
SchI GAGTC 1 cut(s) 797
ScrFI CCNGG 2 cut(s) 13, 404
SduI GDGCHC 1 cut(s) 124
SetI ASST 6 cut(s) 127, 136, 408, 418, 486, 554
SexAI ACCWGGT 1 cut(s) 402
SinI GGWCC 1 cut(s) 16
SphI GCATGC 1 cut(s) 529
SspI AATATT 1 cut(s) 544
SspMI CTAG 1 cut(s) 95
StyD4I CCNGG 2 cut(s) 11, 402
StyI CCWWGG 2 cut(s) 115, 416
TaaI ACNGT 1 cut(s) 112
TaiI ACGT 2 cut(s) 136, 486
TaqI TCGA 2 cut(s) 288, 648
TatI WGTACW 3 cut(s) 351, 361, 472
TfiI GAWTC 3 cut(s) 102, 421, 659
Tru1I TTAA 5 cut(s) 306, 666, 711, 737, 822
Tru9I TTAA 5 cut(s) 306, 666, 711, 737, 822
TscAI CASTG 1 cut(s) 115
TseFI GTSAC 1 cut(s) 173
Tsp45I GTSAC 1 cut(s) 173
TspDTI ATGAA 9 cut(s) 180, 287, 310, 330, 338, 464, 635, 672, 764
TspGWI ACGGA 1 cut(s) 551
TspRI CASTG 1 cut(s) 115
VpaK11BI GGWCC 1 cut(s) 16
VspI ATTAAT 2 cut(s) 306, 711
XapI RAATTY 5 cut(s) 35, 224, 317, 457, 722
XceI RCATGY 3 cut(s) 80, 92, 529
XmiI GTMKAC 1 cut(s) 817
XmnI GAANNNNTTC 1 cut(s) 329
XspI CTAG 1 cut(s) 95
ZrmI AGTACT 1 cut(s) 474
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.