Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0031913.1

Orthogroup ID

OG0012596

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1467

Gene Structure 1467 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0031913.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 731 bp

ggagaatcctcactgtccaaggagcacctaatttacgtgccataagaaggctatttgaggaaatggatgaagatggtgacaatcatatatccattcctgaagtaaaaaaacttcttcaggaaatcaaattcacatcattggaaaatgatgaggacataggaatagcagaagtgatgaaaaagtttgacatcgatcatgatggaaaaattaataaagatgaattcatgaatggcttcacaaaatggcttgatgagtacaagtcagtgcataaagaaaataccgaaagatcgttggaggacatataccaggtttttcaaccttggattcaaaatagaagaaaagaacgcgaaatgaagaagaatttgatgtcagaagtactaagacacgtccaaagcaattcacttggagccattatcacagaaaatggcatgcctcatacggaaaatattagaagcttgtttgaacagattgatcttgatggaaataataatatatcagaagcagaactaagagaactgatcatgaacatcaagtctggtaacattccactcgaagttgatgaatcagttaacaaattggtagaagaacttgacacaagtggagaccatttgattaatgaggaggaattcgttactggattaacaaaatggatgaataaatcccatgatacccaaactctttcgtcattagagtcggaggacgatctctaccaagtaagtatacttaattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EF-hand_7 EF-hand_8 Na_Ca_ex

Protein Analysis

242

Amino Acids

28.12

Weight (kDa)

4.67

Isoelectric Point (pI)

55.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012596)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g18790
malus_domestica	MD03G1238300.v1.1 MD15G1340300.v1.1
prunus_persica	Prupe.4G171600_v2.0.a1 Prupe.4G171600_v2.0.a1
rosa_chinensis	RchiOBHm_Chr5g0031621
rosa_laevigata	RLG00000033329
rosa_multiflora	Rmu_sc0002018.1_g000001 Rmu_sc0003681.1_g000001 Rmu_sc0014819.1_g000001 Rmu_sc0031913.1_g000001
rosa_roxburghii	Rroxscaffold_1G00048660
rosa_rugosa	Rorug05G0127100 Rorug05G0127100
rosa_samantha	Rh5AG220900 Rh5BG220400 Rh5CG243800 Rh5DG225200
rosa_wichuraiana	Rw5G020130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	720
AccII	CGCG	1 cut(s)	347
AcsI	RAATTY	4 cut(s)	127, 220, 360, 625
AcuI	CTGAAG	2 cut(s)	100, 119
AfaI	GTAC	2 cut(s)	256, 377
AfiI	CCNNNNNNNGG	1 cut(s)	47
AflIII	ACRYGT	1 cut(s)	384
AgsI	TTSAA	3 cut(s)	316, 328, 463
AjiI	CACGTC	1 cut(s)	387
AjnI	CCWGG	1 cut(s)	305
AluBI	AGCT	1 cut(s)	455
AluI	AGCT	1 cut(s)	455
Alw21I	GWGCWC	1 cut(s)	27
Alw26I	GTCTC	1 cut(s)	596
ApoI	RAATTY	4 cut(s)	127, 220, 360, 625
AseI	ATTAAT	2 cut(s)	209, 614
Asp700I	GAANNNNTTC	1 cut(s)	232
AsuHPI	GGTGA	1 cut(s)	88
BarI	GAAGNNNNNNTAC	2 cut(s)	95, 127
Bbv12I	GWGCWC	1 cut(s)	27
BccI	CCATC	3 cut(s)	67, 193, 472
BciT130I	CCWGG	1 cut(s)	307
BclI	TGATCA	1 cut(s)	518
BcoDI	GTCTC	1 cut(s)	596
BmcAI	AGTACT	1 cut(s)	377
Bme1390I	CCNGG	1 cut(s)	307
BmgBI	CACGTC	1 cut(s)	387
BmiI	GGNNCC	1 cut(s)	408
BmrFI	CCNGG	1 cut(s)	307
Bsa29I	ATCGAT	1 cut(s)	191
BsaAI	YACGTR	1 cut(s)	37
BsaI	GGTCTC	1 cut(s)	596
BsaJI	CCNNGG	2 cut(s)	18, 319
Bsc4I	CCNNNNNNNGG	1 cut(s)	47
Bse1I	ACTGG	1 cut(s)	639
BseBI	CCWGG	1 cut(s)	307
BseCI	ATCGAT	1 cut(s)	191
BseDI	CCNNGG	2 cut(s)	18, 319
BseGI	GGATG	2 cut(s)	72, 656
BseLI	CCNNNNNNNGG	1 cut(s)	47
BseNI	ACTGG	1 cut(s)	639
BseRI	GAGGAG	1 cut(s)	634
Bsh1236I	CGCG	1 cut(s)	347
BshVI	ATCGAT	1 cut(s)	191
BsiHKAI	GWGCWC	1 cut(s)	27
BslI	CCNNNNNNNGG	1 cut(s)	47
BsmAI	GTCTC	1 cut(s)	596
Bso31I	GGTCTC	1 cut(s)	596
Bsp1286I	GDGCHC	1 cut(s)	27
Bsp143I	GATC	5 cut(s)	192, 286, 471, 518, 702
BspDI	ATCGAT	1 cut(s)	191
BspFNI	CGCG	1 cut(s)	347
BspHI	TCATGA	3 cut(s)	195, 224, 521
BspLI	GGNNCC	1 cut(s)	408
BspTNI	GGTCTC	1 cut(s)	596
BsrI	ACTGG	1 cut(s)	639
BssECI	CCNNGG	2 cut(s)	18, 319
BssMI	GATC	5 cut(s)	192, 286, 471, 518, 702
BssNAI	GTATAC	1 cut(s)	721
BssT1I	CCWWGG	2 cut(s)	18, 319
Bst1107I	GTATAC	1 cut(s)	721
Bst2UI	CCWGG	1 cut(s)	307
Bst4CI	ACNGT	1 cut(s)	15
BstBAI	YACGTR	1 cut(s)	37
BstC8I	GCNNGC	1 cut(s)	430
BstDEI	CTNAG	2 cut(s)	379, 508
BstF5I	GGATG	2 cut(s)	72, 656
BstFNI	CGCG	1 cut(s)	347
BstKTI	GATC	5 cut(s)	195, 289, 474, 521, 705
BstMAI	GTCTC	1 cut(s)	596
BstMBI	GATC	5 cut(s)	192, 286, 471, 518, 702
BstNI	CCWGG	1 cut(s)	307
BstNSI	RCATGY	1 cut(s)	432
BstSCI	CCNGG	1 cut(s)	305
BstUI	CGCG	1 cut(s)	347
BstZ17I	GTATAC	1 cut(s)	721
Bsu15I	ATCGAT	1 cut(s)	191
BsuTUI	ATCGAT	1 cut(s)	191
BtrI	CACGTC	1 cut(s)	387
BtsCI	GGATG	2 cut(s)	72, 656
BtsIMutI	CAGTG	2 cut(s)	11, 269
Cac8I	GCNNGC	1 cut(s)	430
CciI	TCATGA	3 cut(s)	195, 224, 521
ClaI	ATCGAT	1 cut(s)	191
CsiI	ACCWGGT	1 cut(s)	305
Csp6I	GTAC	2 cut(s)	255, 376
CviAII	CATG	5 cut(s)	196, 225, 429, 522, 664
CviJI	RGCY	5 cut(s)	51, 233, 246, 409, 455
CviKI_1	RGCY	5 cut(s)	51, 233, 246, 409, 455
CviQI	GTAC	2 cut(s)	255, 376
DdeI	CTNAG	2 cut(s)	379, 508
DpnI	GATC	5 cut(s)	194, 288, 473, 520, 704
DpnII	GATC	5 cut(s)	192, 286, 471, 518, 702
Eco130I	CCWWGG	2 cut(s)	18, 319
Eco31I	GGTCTC	1 cut(s)	596
Eco57I	CTGAAG	2 cut(s)	100, 119
EcoRI	GAATTC	2 cut(s)	220, 625
EcoRII	CCWGG	1 cut(s)	305
EcoT14I	CCWWGG	2 cut(s)	18, 319
ErhI	CCWWGG	2 cut(s)	18, 319
FaeI	CATG	5 cut(s)	199, 228, 432, 525, 667
FatI	CATG	5 cut(s)	195, 224, 428, 521, 663
FbaI	TGATCA	1 cut(s)	518
FblI	GTMKAC	1 cut(s)	720
FokI	GGATG	2 cut(s)	79, 663
Hin1II	CATG	5 cut(s)	199, 228, 432, 525, 667
HincII	GTYRAC	1 cut(s)	570
HindII	GTYRAC	1 cut(s)	570
HindIII	AAGCTT	1 cut(s)	453
HinfI	GANTC	4 cut(s)	5, 324, 562, 691
HpaI	GTTAAC	1 cut(s)	570
HphI	GGTGA	1 cut(s)	88
Hpy166II	GTNNAC	2 cut(s)	570, 721
Hpy188I	TCNGA	3 cut(s)	372, 498, 696
Hpy188III	TCNNGA	6 cut(s)	97, 118, 196, 225, 475, 522
Hpy8I	GTNNAC	2 cut(s)	570, 721
HpyAV	CCTTC	1 cut(s)	41
HpyCH4III	ACNGT	1 cut(s)	15
HpyCH4IV	ACGT	2 cut(s)	36, 386
HpyCH4V	TGCA	1 cut(s)	267
HpyF3I	CTNAG	2 cut(s)	379, 508
HpySE526I	ACGT	2 cut(s)	36, 386
Hsp92II	CATG	5 cut(s)	199, 228, 432, 525, 667
Ksp22I	TGATCA	1 cut(s)	518
KspAI	GTTAAC	1 cut(s)	570
Kzo9I	GATC	5 cut(s)	192, 286, 471, 518, 702
LmnI	GCTCC	2 cut(s)	22, 406
LpnPI	CCDG	6 cut(s)	103, 110, 292, 319, 521, 620
MabI	ACCWGGT	1 cut(s)	305
MaeII	ACGT	2 cut(s)	36, 386
MaeIII	GTNAC	3 cut(s)	76, 538, 630
MalI	GATC	5 cut(s)	194, 288, 473, 520, 704
MboI	GATC	5 cut(s)	192, 286, 471, 518, 702
MboII	GAAGA	6 cut(s)	82, 106, 347, 366, 369, 595
MhlI	GDGCHC	1 cut(s)	27
MluCI	AATT	9 cut(s)	30, 127, 206, 220, 360, 396, 574, 625, 726
MlyI	GAGTC	1 cut(s)	700
MmeI	TCCRAC	2 cut(s)	272, 674
MnlI	CCTC	8 cut(s)	19, 51, 144, 288, 443, 612, 615, 690
MroXI	GAANNNNTTC	1 cut(s)	232
MseI	TTAA	5 cut(s)	209, 569, 614, 640, 725
MspR9I	CCNGG	1 cut(s)	307
MvaI	CCWGG	1 cut(s)	307
MvnI	CGCG	1 cut(s)	347
NdeII	GATC	5 cut(s)	192, 286, 471, 518, 702
NlaIII	CATG	5 cut(s)	199, 228, 432, 525, 667
NlaIV	GGNNCC	1 cut(s)	408
NmuCI	GTSAC	1 cut(s)	76
NspI	RCATGY	1 cut(s)	432
PaeI	GCATGC	1 cut(s)	432
PagI	TCATGA	3 cut(s)	195, 224, 521
PdmI	GAANNNNTTC	1 cut(s)	232
PfeI	GAWTC	3 cut(s)	5, 324, 562
PleI	GAGTC	1 cut(s)	699
PpsI	GAGTC	1 cut(s)	699
Ppu21I	YACGTR	1 cut(s)	37
PshBI	ATTAAT	2 cut(s)	209, 614
Psp6I	CCWGG	1 cut(s)	305
PspGI	CCWGG	1 cut(s)	305
PspN4I	GGNNCC	1 cut(s)	408
RsaI	GTAC	2 cut(s)	256, 377
RsaNI	GTAC	2 cut(s)	255, 376
SaqAI	TTAA	5 cut(s)	209, 569, 614, 640, 725
Sau3AI	GATC	5 cut(s)	192, 286, 471, 518, 702
ScaI	AGTACT	1 cut(s)	377
SchI	GAGTC	1 cut(s)	700
ScrFI	CCNGG	1 cut(s)	307
SduI	GDGCHC	1 cut(s)	27
SetI	ASST	6 cut(s)	30, 39, 311, 321, 389, 457
SexAI	ACCWGGT	1 cut(s)	305
SphI	GCATGC	1 cut(s)	432
Sse9I	AATT	9 cut(s)	30, 127, 206, 220, 360, 396, 574, 625, 726
SspI	AATATT	1 cut(s)	447
StyD4I	CCNGG	1 cut(s)	305
StyI	CCWWGG	2 cut(s)	18, 319
TaaI	ACNGT	1 cut(s)	15
TaiI	ACGT	2 cut(s)	39, 389
TaqI	TCGA	2 cut(s)	191, 551
TasI	AATT	9 cut(s)	30, 127, 206, 220, 360, 396, 574, 625, 726
TatI	WGTACW	2 cut(s)	254, 375
TfiI	GAWTC	3 cut(s)	5, 324, 562
Tru1I	TTAA	5 cut(s)	209, 569, 614, 640, 725
Tru9I	TTAA	5 cut(s)	209, 569, 614, 640, 725
TscAI	CASTG	2 cut(s)	18, 269
TseFI	GTSAC	1 cut(s)	76
Tsp45I	GTSAC	1 cut(s)	76
TspDTI	ATGAA	9 cut(s)	83, 190, 213, 233, 241, 367, 538, 575, 667
TspGWI	ACGGA	1 cut(s)	454
TspRI	CASTG	2 cut(s)	18, 269
VspI	ATTAAT	2 cut(s)	209, 614
XapI	RAATTY	4 cut(s)	127, 220, 360, 625
XceI	RCATGY	1 cut(s)	432
XmiI	GTMKAC	1 cut(s)	720
XmnI	GAANNNNTTC	1 cut(s)	232
ZrmI	AGTACT	1 cut(s)	377

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.