Rmu_sc0004046.1_g000013

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004046.1
Physical Location & Seq
Forward (+)
67102 .. 67392
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004046.1_g000013.1.cds

Sequence Viewer

Length: 291 bp
atgtcaatgaagaagaacagttgcgtgtggttcgtgttgggcctggcgatactgatcgtgtcgactgagtttgttcaagttgattgcagagcgcttcgatccgactcggcgactggtgagggatgcaaagagcaggctggtggagctgaggagatggccggaatgggaagctttgcggtttcgtctagtttcaactcatcgagcaatgataatagaactcatcggccttcggtgaggagcttgatgtttaggttggcttctggacctagcaaaaaaggtcctggccattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.19

Weight (kDa)

9.02

Isoelectric Point (pI)

49.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015049)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G47130 AT5G43064 AT5G43066 AT5G43068
fragaria_vesca FvH4_2g33680
prunus_persica Prupe.1G429100_v2.0.a1
pyrus_communis pycom08g07400 pycom15g07090
rosa_laevigata RLG00000010610
rosa_multiflora Rmu_sc0004046.1_g000013
rosa_roxburghii Rroxscaffold_7G00159830
rosa_rugosa Rorug06G0368900
rosa_samantha Rh6AG480400 Rh6CG495300 Rh6DG480700
rosa_wichuraiana Rw6G041870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 62
AciI CCGC 1 cut(s) 176
AclWI GGATC 1 cut(s) 93
AcoI YGGCCR 2 cut(s) 156, 283
AfeI AGCGCT 1 cut(s) 93
AgsI TTSAA 2 cut(s) 77, 193
AjnI CCWGG 2 cut(s) 42, 280
AluBI AGCT 3 cut(s) 146, 171, 240
AluI AGCT 3 cut(s) 146, 171, 240
AlwI GGATC 1 cut(s) 93
Aor51HI AGCGCT 1 cut(s) 93
AoxI GGCC 4 cut(s) 40, 156, 224, 283
AspLEI GCGC 1 cut(s) 94
AspS9I GGNCC 3 cut(s) 40, 263, 278
AsuHPI GGTGA 2 cut(s) 128, 244
AvaII GGWCC 2 cut(s) 263, 278
BalI TGGCCA 1 cut(s) 285
BbvCI CCTCAGC 1 cut(s) 147
BccI CCATC 1 cut(s) 148
BciT130I CCWGG 2 cut(s) 44, 282
BfaI CTAG 2 cut(s) 186, 267
BfoI RGCGCY 1 cut(s) 95
Bme1390I CCNGG 2 cut(s) 44, 282
Bme18I GGWCC 2 cut(s) 263, 278
BmgT120I GGNCC 3 cut(s) 40, 263, 278
BmrFI CCNGG 2 cut(s) 44, 282
BmsI GCATC 1 cut(s) 113
Bpu10I CCTNAGC 1 cut(s) 147
BsaBI GATNNNNATC 1 cut(s) 53
Bse1I ACTGG 1 cut(s) 118
Bse3DI GCAATG 1 cut(s) 211
Bse8I GATNNNNATC 1 cut(s) 53
BseBI CCWGG 2 cut(s) 44, 282
BseGI GGATG 1 cut(s) 128
BseJI GATNNNNATC 1 cut(s) 53
BseMI GCAATG 1 cut(s) 211
BseMII CTCAG 2 cut(s) 57, 138
BseNI ACTGG 1 cut(s) 118
BseRI GAGGAG 2 cut(s) 164, 250
BshFI GGCC 4 cut(s) 42, 158, 226, 285
BsiSI CCGG 1 cut(s) 159
BsnI GGCC 4 cut(s) 42, 158, 226, 285
Bsp143I GATC 2 cut(s) 54, 98
BspACI CCGC 1 cut(s) 176
BspANI GGCC 4 cut(s) 42, 158, 226, 285
BspCNI CTCAG 2 cut(s) 58, 139
BspPI GGATC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 211
BsrI ACTGG 1 cut(s) 118
BssMI GATC 2 cut(s) 54, 98
Bst2UI CCWGG 2 cut(s) 44, 282
Bst4CI ACNGT 1 cut(s) 20
BstC8I GCNNGC 1 cut(s) 135
BstDEI CTNAG 2 cut(s) 66, 147
BstF5I GGATG 1 cut(s) 128
BstH2I RGCGCY 1 cut(s) 95
BstHHI GCGC 1 cut(s) 94
BstKTI GATC 2 cut(s) 57, 101
BstMBI GATC 2 cut(s) 54, 98
BstMWI GCNNNNNNNGC 1 cut(s) 143
BstNI CCWGG 2 cut(s) 44, 282
BstSCI CCNGG 2 cut(s) 42, 280
BsuRI GGCC 4 cut(s) 42, 158, 226, 285
BtsCI GGATG 1 cut(s) 128
Cac8I GCNNGC 1 cut(s) 135
CfoI GCGC 1 cut(s) 94
Cfr13I GGNCC 3 cut(s) 40, 263, 278
CviJI RGCY 9 cut(s) 42, 137, 146, 158, 171, 226, 240, 257, 285
CviKI_1 RGCY 9 cut(s) 42, 137, 146, 158, 171, 226, 240, 257, 285
DdeI CTNAG 2 cut(s) 66, 147
DpnI GATC 2 cut(s) 56, 100
DpnII GATC 2 cut(s) 54, 98
EaeI YGGCCR 2 cut(s) 156, 283
Eco47I GGWCC 2 cut(s) 263, 278
Eco47III AGCGCT 1 cut(s) 93
EcoO109I RGGNCCY 1 cut(s) 278
EcoRII CCWGG 2 cut(s) 42, 280
FblI GTMKAC 1 cut(s) 62
FokI GGATG 1 cut(s) 135
FspBI CTAG 2 cut(s) 186, 267
GlaI GCGC 1 cut(s) 93
HaeII RGCGCY 1 cut(s) 95
HaeIII GGCC 4 cut(s) 42, 158, 226, 285
HapII CCGG 1 cut(s) 159
HhaI GCGC 1 cut(s) 94
Hin6I GCGC 1 cut(s) 92
HinP1I GCGC 1 cut(s) 92
HincII GTYRAC 1 cut(s) 63
HindII GTYRAC 1 cut(s) 63
HindIII AAGCTT 1 cut(s) 169
HinfI GANTC 1 cut(s) 104
HpaII CCGG 1 cut(s) 159
HphI GGTGA 2 cut(s) 128, 244
Hpy166II GTNNAC 1 cut(s) 63
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 1 cut(s) 261
Hpy8I GTNNAC 1 cut(s) 63
HpyAV CCTTC 1 cut(s) 237
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4V TGCA 2 cut(s) 87, 126
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
HpyF3I CTNAG 2 cut(s) 66, 147
HspAI GCGC 1 cut(s) 92
Kzo9I GATC 2 cut(s) 54, 98
LmnI GCTCC 2 cut(s) 143, 237
LpnPI CCDG 8 cut(s) 29, 56, 99, 119, 123, 172, 246, 267
LweI GCATC 1 cut(s) 113
MaeI CTAG 2 cut(s) 186, 267
MalI GATC 2 cut(s) 56, 100
MboI GATC 2 cut(s) 54, 98
MboII GAAGA 2 cut(s) 22, 25
MlsI TGGCCA 1 cut(s) 285
MluNI TGGCCA 1 cut(s) 285
MlyI GAGTC 1 cut(s) 98
MmeI TCCRAC 1 cut(s) 126
MnlI CCTC 3 cut(s) 112, 142, 228
Mox20I TGGCCA 1 cut(s) 285
MscI TGGCCA 1 cut(s) 285
Msp20I TGGCCA 1 cut(s) 285
MspI CCGG 1 cut(s) 159
MspR9I CCNGG 2 cut(s) 44, 282
MvaI CCWGG 2 cut(s) 44, 282
MwoI GCNNNNNNNGC 1 cut(s) 143
NdeII GATC 2 cut(s) 54, 98
NmeAIII GCCGAG 1 cut(s) 86
PleI GAGTC 1 cut(s) 98
PpsI GAGTC 1 cut(s) 98
PpuMI RGGWCCY 1 cut(s) 278
Psp5II RGGWCCY 1 cut(s) 278
Psp6I CCWGG 2 cut(s) 42, 280
PspGI CCWGG 2 cut(s) 42, 280
PspPI GGNCC 3 cut(s) 40, 263, 278
PspPPI RGGWCCY 1 cut(s) 278
SalI GTCGAC 1 cut(s) 61
Sau3AI GATC 2 cut(s) 54, 98
Sau96I GGNCC 3 cut(s) 40, 263, 278
SchI GAGTC 1 cut(s) 98
ScrFI CCNGG 2 cut(s) 44, 282
SetI ASST 6 cut(s) 148, 173, 242, 254, 268, 280
SfaNI GCATC 1 cut(s) 113
SinI GGWCC 2 cut(s) 263, 278
SsiI CCGC 1 cut(s) 176
SspMI CTAG 2 cut(s) 186, 267
StyD4I CCNGG 2 cut(s) 42, 280
TaaI ACNGT 1 cut(s) 20
TaqI TCGA 3 cut(s) 62, 97, 200
TspDTI ATGAA 1 cut(s) 23
VpaK11BI GGWCC 2 cut(s) 263, 278
XmiI GTMKAC 1 cut(s) 62
XspI CTAG 2 cut(s) 186, 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.