Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004277.1

Orthogroup ID

OG0007439

Physical Location & Seq

Genomic Coordinates Reverse (-)

291281 .. 300455

Gene Structure 9175 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004277.1_g000083.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1593 bp

atggacaaattcttagtccctctcaaaccctcacctcaactttccaccaaacccattcgaaggcgaagatggcatcggagcctcatcgaattgaacggaaagcccgaacccaagtaccggcattccgtctctggtttactcatgcaatcctattccgagcttagggcgtttcggcatttgtaccacatcgacggaaacccgtgtcaaacccatgtgaatcgggtggtgattaatggcacgtacatacccccaagtttaaaggaaggagtttctgccctggattttgacaacaaggggatatacctggcatctgtgacaagatcggggtgcttaacggtgcatgattttgaaactctttattgccagagtaatgaaccattgctacgcttggaagaagatgaagcaaaacatgtgctgcatctttctttacatcaacaactagactttgtccggtggaattgtgccaaccaagatgaggttgtttgcacatctatgaaaaggaatgaagtacttatatttgacattagttatatatcttctacaccatccgaagttttaagaacaaaaccgcgtcctgctatctttgggtctaatattcagaaaggtctttctgatattgcctttacctcctgtgaagactcaagggtacttgcttctgatacagatggtgttattcatatatgggacagaagaactagtacttttccttgtcttgaacttacggcaaattcccgtggcagccttaatagtatccaattaaatgtggaaaatcagatcatttttggagctggaaagcatggggtgatccatgcttgggatcttcgtggtgggagaacgtcttctttcttcaagggttctaaagaggtatctcgtccacctctaacctcactgaagttatcatcaacattggaaaaaattgggcctctaaaggaacaatcagccattgtttctaaggaaatacactccattaatcttgatccgtcttgcccacaccaattggcattccatcttgatgacggttggtcaggcgtgctggatattcataatcttgaagttacacatattcattgtcctccaccagcttggttaaatgaatctgttgggtcagatctatcatatttgagaaaaccttcatggctacctacaaactctatatatgtggttggatcatcaactgataacggcattcatattttggatttttatccagattcaagctctccttgtcatgtggactacaatgaggatgcacatcgtctttctggggtaaaggatcaagataagcaaaacaggagcaattctacagaggagcatttgtttaaacatagggatgactgcagaatagtgtttgagttcgacaagttgagtcaagatttgattgaaagggataacagaagaaggcagaggacgggagtgaagcatttgatgaaacaacatggaggcatcctcaacattactcacaatattgggtcgatttcgttgatgggtttgtctcgaatgaaacaaagccatgaaattgttgatcaggggaacagcaagatgagtagaggaagacaagaaagcatacctcttgtgctgctgcttttgcagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

530

Amino Acids

59.98

Weight (kDa)

7.69

Isoelectric Point (pI)

59.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007439)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G12920 AT5G12920 AT5G12920 AT5G12920 AT5G12920 AT5G12920 AT5G12920 AT5G12920
fragaria_vesca	FvH4_3g43320 FvH4_3g43320
malus_domestica	MD11G1027100.v1.1
prunus_persica	Prupe.6G021400_v2.0.a1 Prupe.6G021400_v2.0.a1 Prupe.6G021400_v2.0.a1
pyrus_communis	pycom11g02070
rosa_chinensis	RchiOBHm_Chr5g0077431
rosa_laevigata	RLG00000036696
rosa_multiflora	Rmu_sc0004277.1_g000083
rosa_roxburghii	Rroxscaffold_1G00004480
rosa_rugosa	Rorug05G0454900
rosa_samantha	Rh5AG509900 Rh5BG531500 Rh5CG555800 Rh5DG543600
rosa_wichuraiana	Rw5G046770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	571
AciI	CCGC	1 cut(s)	569
AclWI	GGATC	5 cut(s)	799, 825, 971, 1174, 1281
AcsI	RAATTY	2 cut(s)	8, 727
AcuI	CTGAAG	1 cut(s)	911
AfaI	GTAC	6 cut(s)	116, 182, 242, 510, 648, 700
AfiI	CCNNNNNNNGG	5 cut(s)	60, 117, 162, 475, 814
AflIII	ACRYGT	1 cut(s)	409
AgsI	TTSAA	7 cut(s)	94, 350, 716, 850, 1052, 1215, 1382
AhdI	GACNNNNNGTC	1 cut(s)	1021
AhlI	ACTAGT	1 cut(s)	695
AjnI	CCWGG	2 cut(s)	276, 303
AluBI	AGCT	4 cut(s)	160, 788, 1082, 1218
AluI	AGCT	4 cut(s)	160, 788, 1082, 1218
Alw26I	GTCTC	2 cut(s)	133, 1497
AlwI	GGATC	5 cut(s)	799, 825, 971, 1174, 1281
AoxI	GGCC	1 cut(s)	920
ApeKI	GCWGC	4 cut(s)	415, 738, 1576, 1579
ApoI	RAATTY	2 cut(s)	8, 727
ArsI	GACNNNNNNTTYG	1 cut(s)	32
AseI	ATTAAT	2 cut(s)	231, 969
Asp700I	GAANNNNTTC	2 cut(s)	838, 1129
AspS9I	GGNCC	1 cut(s)	920
AsuHPI	GGTGA	3 cut(s)	24, 238, 814
AsuII	TTCGAA	1 cut(s)	58
BaeI	ACNNNNGTAYC	2 cut(s)	98, 131
BarI	GAAGNNNNNNTAC	2 cut(s)	682, 714
BbsI	GAAGAC	3 cut(s)	642, 831, 1558
BbvI	GCAGC	4 cut(s)	402, 750, 1563, 1566
BccI	CCATC	5 cut(s)	63, 553, 659, 1014, 1477
BceAI	ACGGC	2 cut(s)	738, 1198
BciT130I	CCWGG	2 cut(s)	278, 305
BciVI	GTATCC	1 cut(s)	761
BclI	TGATCA	1 cut(s)	1522
BcoDI	GTCTC	2 cut(s)	133, 1497
BcuI	ACTAGT	1 cut(s)	695
BfaI	CTAG	2 cut(s)	440, 696
BfmI	CTRYAG	2 cut(s)	1302, 1336
BfuI	GTATCC	1 cut(s)	761
BglII	AGATCT	1 cut(s)	1108
BisI	GCNGC	4 cut(s)	416, 739, 1577, 1580
BlsI	GCNGC	4 cut(s)	417, 740, 1578, 1581
BmcAI	AGTACT	2 cut(s)	510, 700
Bme1390I	CCNGG	2 cut(s)	278, 305
BmeRI	GACNNNNNGTC	1 cut(s)	1021
BmgT120I	GGNCC	1 cut(s)	920
BmiI	GGNNCC	1 cut(s)	80
BmrFI	CCNGG	2 cut(s)	278, 305
BmsI	GCATC	5 cut(s)	82, 317, 427, 1237, 1452
BpiI	GAAGAC	3 cut(s)	642, 831, 1558
BplI	GAGNNNNNCTC	2 cut(s)	1431, 1463
Bpu10I	CCTNAGC	1 cut(s)	161
Bpu14I	TTCGAA	1 cut(s)	58
BpuEI	CTTGAG	1 cut(s)	625
BsaAI	YACGTR	1 cut(s)	240
BsaBI	GATNNNNATC	2 cut(s)	1203, 1251
BsaJI	CCNNGG	2 cut(s)	276, 733
BsaWI	WCCGGW	1 cut(s)	450
BsaXI	ACNNNNNCTCC	2 cut(s)	1301, 1331
Bsc4I	CCNNNNNNNGG	5 cut(s)	60, 117, 162, 475, 814
Bse118I	RCCGGY	1 cut(s)	117
Bse3DI	GCAATG	1 cut(s)	377
Bse8I	GATNNNNATC	2 cut(s)	1203, 1251
BseBI	CCWGG	2 cut(s)	278, 305
BseDI	CCNNGG	2 cut(s)	276, 733
BseGI	GGATG	4 cut(s)	545, 1252, 1336, 1443
BseJI	GATNNNNATC	2 cut(s)	1203, 1251
BseLI	CCNNNNNNNGG	5 cut(s)	60, 117, 162, 475, 814
BseMI	GCAATG	1 cut(s)	377
BseRI	GAGGAG	1 cut(s)	1322
BseXI	GCAGC	4 cut(s)	402, 750, 1563, 1566
Bsh1236I	CGCG	1 cut(s)	571
BshFI	GGCC	1 cut(s)	922
BsiSI	CCGG	2 cut(s)	118, 451
BslFI	GGGAC	2 cut(s)	2, 698
BslI	CCNNNNNNNGG	5 cut(s)	60, 117, 162, 475, 814
BsmAI	GTCTC	2 cut(s)	133, 1497
BsmBI	CGTCTC	1 cut(s)	133
BsmFI	GGGAC	2 cut(s)	2, 698
BsmI	GAATGC	3 cut(s)	121, 1001, 1185
BsnI	GGCC	1 cut(s)	922
Bsp119I	TTCGAA	1 cut(s)	58
Bsp143I	GATC	9 cut(s)	320, 774, 804, 817, 976, 1108, 1166, 1273, 1522
BspACI	CCGC	1 cut(s)	569
BspANI	GGCC	1 cut(s)	922
BspFNI	CGCG	1 cut(s)	571
BspLI	GGNNCC	1 cut(s)	80
BspMAI	CTGCAG	1 cut(s)	1340
BspPI	GGATC	5 cut(s)	799, 825, 971, 1174, 1281
BspT104I	TTCGAA	1 cut(s)	58
BsrDI	GCAATG	1 cut(s)	377
BsrFI	RCCGGY	1 cut(s)	117
BssAI	RCCGGY	1 cut(s)	117
BssECI	CCNNGG	2 cut(s)	276, 733
BssMI	GATC	9 cut(s)	320, 774, 804, 817, 976, 1108, 1166, 1273, 1522
Bst2UI	CCWGG	2 cut(s)	278, 305
Bst4CI	ACNGT	2 cut(s)	337, 1019
BstBAI	YACGTR	1 cut(s)	240
BstBI	TTCGAA	1 cut(s)	58
BstC8I	GCNNGC	1 cut(s)	1031
BstDEI	CTNAG	3 cut(s)	13, 161, 951
BstDSI	CCRYGG	1 cut(s)	733
BstF5I	GGATG	4 cut(s)	545, 1252, 1336, 1443
BstFNI	CGCG	1 cut(s)	571
BstKTI	GATC	9 cut(s)	323, 777, 807, 820, 979, 1111, 1169, 1276, 1525
BstMAI	GTCTC	2 cut(s)	133, 1497
BstMBI	GATC	9 cut(s)	320, 774, 804, 817, 976, 1108, 1166, 1273, 1522
BstMWI	GCNNNNNNNGC	2 cut(s)	70, 1585
BstNI	CCWGG	2 cut(s)	278, 305
BstNSI	RCATGY	1 cut(s)	413
BstSCI	CCNGG	2 cut(s)	276, 303
BstSFI	CTRYAG	2 cut(s)	1302, 1336
BstUI	CGCG	1 cut(s)	571
BstV1I	GCAGC	4 cut(s)	402, 750, 1563, 1566
BstV2I	GAAGAC	3 cut(s)	642, 831, 1558
BstX2I	RGATCY	2 cut(s)	817, 1108
BstXI	CCANNNNNNTGG	1 cut(s)	1083
BstYI	RGATCY	2 cut(s)	817, 1108
BsuI	GTATCC	1 cut(s)	761
BsuRI	GGCC	1 cut(s)	922
BtgI	CCRYGG	1 cut(s)	733
BtsCI	GGATG	4 cut(s)	545, 1252, 1336, 1443
BtsIMutI	CAGTG	1 cut(s)	887
Cac8I	GCNNGC	1 cut(s)	1031
Cfr10I	RCCGGY	1 cut(s)	117
Cfr13I	GGNCC	1 cut(s)	920
CseI	GACGC	1 cut(s)	560
Csp6I	GTAC	6 cut(s)	115, 181, 241, 509, 647, 699
CspCI	CAANNNNNGTGG	2 cut(s)	978, 1013
CviQI	GTAC	6 cut(s)	115, 181, 241, 509, 647, 699
DdeI	CTNAG	3 cut(s)	13, 161, 951
DpnI	GATC	9 cut(s)	322, 776, 806, 819, 978, 1110, 1168, 1275, 1524
DpnII	GATC	9 cut(s)	320, 774, 804, 817, 976, 1108, 1166, 1273, 1522
DraI	TTTAAA	2 cut(s)	258, 1321
DriI	GACNNNNNGTC	1 cut(s)	1021
Eam1105I	GACNNNNNGTC	1 cut(s)	1021
Eco57I	CTGAAG	1 cut(s)	911
EcoRII	CCWGG	2 cut(s)	276, 303
Esp3I	CGTCTC	1 cut(s)	133
FalI	AAGNNNNNCTT	2 cut(s)	1207, 1239
FaqI	GGGAC	2 cut(s)	2, 698
FbaI	TGATCA	1 cut(s)	1522
Fnu4HI	GCNGC	4 cut(s)	416, 739, 1577, 1580
FokI	GGATG	4 cut(s)	532, 1259, 1343, 1430
Fsp4HI	GCNGC	4 cut(s)	416, 739, 1577, 1580
FspBI	CTAG	2 cut(s)	440, 696
GluI	GCNGC	4 cut(s)	416, 739, 1577, 1580
HaeIII	GGCC	1 cut(s)	922
HapII	CCGG	2 cut(s)	118, 451
HgaI	GACGC	1 cut(s)	560
HinfI	GANTC	5 cut(s)	217, 638, 1094, 1211, 1366
HpaII	CCGG	2 cut(s)	118, 451
HphI	GGTGA	3 cut(s)	24, 238, 814
Hpy166II	GTNNAC	3 cut(s)	137, 875, 1234
Hpy188I	TCNGA	8 cut(s)	78, 157, 550, 600, 613, 658, 774, 1108
Hpy188III	TCNNGA	8 cut(s)	713, 974, 1010, 1049, 1208, 1277, 1370, 1494
Hpy8I	GTNNAC	3 cut(s)	137, 875, 1234
Hpy99I	CGWCG	1 cut(s)	194
HpyAV	CCTTC	4 cut(s)	54, 257, 1140, 1392
HpyCH4III	ACNGT	2 cut(s)	337, 1019
HpyCH4IV	ACGT	2 cut(s)	239, 836
HpyCH4V	TGCA	7 cut(s)	145, 340, 418, 486, 1250, 1338, 1588
HpyF10VI	GCNNNNNNNGC	2 cut(s)	70, 1585
HpyF3I	CTNAG	3 cut(s)	13, 161, 951
HpySE526I	ACGT	2 cut(s)	239, 836
Ksp22I	TGATCA	1 cut(s)	1522
Kzo9I	GATC	9 cut(s)	320, 774, 804, 817, 976, 1108, 1166, 1273, 1522
LmnI	GCTCC	4 cut(s)	78, 785, 1293, 1309
Lsp1109I	GCAGC	4 cut(s)	402, 750, 1563, 1566
LweI	GCATC	5 cut(s)	82, 317, 427, 1237, 1452
MaeI	CTAG	2 cut(s)	440, 696
MaeII	ACGT	2 cut(s)	239, 836
MaeIII	GTNAC	2 cut(s)	313, 1054
MalI	GATC	9 cut(s)	322, 776, 806, 819, 978, 1110, 1168, 1275, 1524
MboI	GATC	9 cut(s)	320, 774, 804, 817, 976, 1108, 1166, 1273, 1522
MfeI	CAATTG	1 cut(s)	995
MflI	RGATCY	2 cut(s)	817, 1108
MluCI	AATT	9 cut(s)	8, 89, 457, 727, 755, 915, 995, 1297, 1515
MlyI	GAGTC	2 cut(s)	632, 1375
MmeI	TCCRAC	1 cut(s)	1144
MroXI	GAANNNNTTC	2 cut(s)	838, 1129
MseI	TTAA	9 cut(s)	231, 257, 332, 557, 744, 758, 969, 1088, 1320
MslI	CAYNNNNRTG	3 cut(s)	491, 1011, 1329
MspI	CCGG	2 cut(s)	118, 451
MspR9I	CCNGG	2 cut(s)	278, 305
MssI	GTTTAAAC	1 cut(s)	1321
MunI	CAATTG	1 cut(s)	995
Mva1269I	GAATGC	3 cut(s)	121, 1001, 1185
MvaI	CCWGG	2 cut(s)	278, 305
MvnI	CGCG	1 cut(s)	571
MwoI	GCNNNNNNNGC	2 cut(s)	70, 1585
NdeII	GATC	9 cut(s)	320, 774, 804, 817, 976, 1108, 1166, 1273, 1522
NlaIV	GGNNCC	1 cut(s)	80
NmuCI	GTSAC	1 cut(s)	313
NspI	RCATGY	1 cut(s)	413
NspV	TTCGAA	1 cut(s)	58
PciI	ACATGT	1 cut(s)	409
PcsI	WCGNNNNNNNCGW	1 cut(s)	102
PctI	GAATGC	3 cut(s)	121, 1001, 1185
PdmI	GAANNNNTTC	2 cut(s)	838, 1129
PfeI	GAWTC	3 cut(s)	217, 1094, 1211
PflFI	GACNNNGTC	1 cut(s)	446
PkrI	GCNGC	4 cut(s)	417, 740, 1578, 1581
PleI	GAGTC	2 cut(s)	632, 1374
PmeI	GTTTAAAC	1 cut(s)	1321
PpsI	GAGTC	2 cut(s)	632, 1374
Ppu21I	YACGTR	1 cut(s)	240
PscI	ACATGT	1 cut(s)	409
PshBI	ATTAAT	2 cut(s)	231, 969
Psp6I	CCWGG	2 cut(s)	276, 303
PspGI	CCWGG	2 cut(s)	276, 303
PspN4I	GGNNCC	1 cut(s)	80
PspPI	GGNCC	1 cut(s)	920
PsrI	GAACNNNNNNTAC	2 cut(s)	366, 398
PstI	CTGCAG	1 cut(s)	1340
PsuI	RGATCY	2 cut(s)	817, 1108
PsyI	GACNNNGTC	1 cut(s)	446
RsaI	GTAC	6 cut(s)	116, 182, 242, 510, 648, 700
RsaNI	GTAC	6 cut(s)	115, 181, 241, 509, 647, 699
RseI	CAYNNNNRTG	3 cut(s)	491, 1011, 1329
SaqAI	TTAA	9 cut(s)	231, 257, 332, 557, 744, 758, 969, 1088, 1320
SatI	GCNGC	4 cut(s)	416, 739, 1577, 1580
Sau3AI	GATC	9 cut(s)	320, 774, 804, 817, 976, 1108, 1166, 1273, 1522
Sau96I	GGNCC	1 cut(s)	920
ScaI	AGTACT	2 cut(s)	510, 700
SchI	GAGTC	2 cut(s)	632, 1375
ScrFI	CCNGG	2 cut(s)	278, 305
SfaNI	GCATC	5 cut(s)	82, 317, 427, 1237, 1452
SfcI	CTRYAG	2 cut(s)	1302, 1336
SfuI	TTCGAA	1 cut(s)	58
SmiMI	CAYNNNNRTG	3 cut(s)	491, 1011, 1329
SmlI	CTYRAG	1 cut(s)	640
SmoI	CTYRAG	1 cut(s)	640
SpeI	ACTAGT	1 cut(s)	695
Sse9I	AATT	9 cut(s)	8, 89, 457, 727, 755, 915, 995, 1297, 1515
SsiI	CCGC	1 cut(s)	569
SspI	AATATT	2 cut(s)	595, 1465
SspMI	CTAG	2 cut(s)	440, 696
StyD4I	CCNGG	2 cut(s)	276, 303
TaaI	ACNGT	2 cut(s)	337, 1019
TaiI	ACGT	2 cut(s)	242, 839
TaqI	TCGA	6 cut(s)	58, 87, 189, 1356, 1472, 1495
TasI	AATT	9 cut(s)	8, 89, 457, 727, 755, 915, 995, 1297, 1515
TatI	WGTACW	2 cut(s)	508, 698
TfiI	GAWTC	3 cut(s)	217, 1094, 1211
Tru1I	TTAA	9 cut(s)	231, 257, 332, 557, 744, 758, 969, 1088, 1320
Tru9I	TTAA	9 cut(s)	231, 257, 332, 557, 744, 758, 969, 1088, 1320
TscAI	CASTG	1 cut(s)	894
TseFI	GTSAC	1 cut(s)	313
TseI	GCWGC	4 cut(s)	415, 738, 1576, 1579
Tsp45I	GTSAC	1 cut(s)	313
TspGWI	ACGGA	4 cut(s)	111, 115, 207, 969
TspRI	CASTG	1 cut(s)	894
Tth111I	GACNNNGTC	1 cut(s)	446
VspI	ATTAAT	2 cut(s)	231, 969
XapI	RAATTY	2 cut(s)	8, 727
XceI	RCATGY	1 cut(s)	413
XmnI	GAANNNNTTC	2 cut(s)	838, 1129
XspI	CTAG	2 cut(s)	440, 696
ZrmI	AGTACT	2 cut(s)	510, 700

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.