Rmu_sc0004359.1_g000048
MYB Family

Transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004359.1
Physical Location & Seq
Reverse (-)
203076 .. 204189
1114 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004359.1_g000048.1.cds

Sequence Viewer

Length: 891 bp
atggggagaagcccttgttgtgctaaggagggcttgaatagaggtgcatggactgctctcgaagatagagatctgactgaatacatcaaagttcatggcgaaggaagatggagaaacctccccaaaaaagcaggactgaaaaggtgtgggaagagctgcaggcttaggtggttgaactatttgagaccagacattaagagaggcaacatatcacctgatgaagaagagctcatcgtcaagcttcacaagctcttgggcaacagatggtctctaatagcgggtaggctaccagggcgaacagacaatgaaataaaaaactactggaacaccaatctgagcaaaagaattcaagaccaagaagctcgctcatcgccctcatcagctggtggtgaagaaccaaaatcaaaaaaggccaagaatgttatggcctcgccattttcccataatgtgataagaacaaaagctgccaagtgcaacaaagttttcatcaacccacagttgccacacaaagggttgttccagatggatgatcacaggcctatggatcatcatcaacatgtagatcatcgacctgatgagaatgggttgtcattgtcgccatctttgttggaaacctcgtcttcatcagagttcctggtggatttcggcatgaattccgacctttgcctggccagtctcctcagttcgaaattttcaagtggtgattacttgttctctgaagaaatgcagctgcaagagcaatattggagtggtaatgttggtagtggtgaggattgtgttgttgacgatcaacttcaaccaaatacggtcctcaatttccagtcattgaattattttctcgatgctgatgctaaccaaggagactggctcgaacttgcagagagtagttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

296

Amino Acids

33.43

Weight (kDa)

6.51

Isoelectric Point (pI)

53.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016234)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 278
AclWI GGATC 1 cut(s) 552
AcoI YGGCCR 1 cut(s) 669
AcsI RAATTY 3 cut(s) 345, 652, 689
AcuI CTGAAG 1 cut(s) 738
AfiI CCNNNNNNNGG 2 cut(s) 509, 667
AflIII ACRYGT 1 cut(s) 556
AgsI TTSAA 6 cut(s) 37, 175, 350, 696, 797, 829
AjnI CCWGG 3 cut(s) 289, 633, 666
AluBI AGCT 8 cut(s) 156, 229, 241, 250, 362, 383, 464, 730
AluI AGCT 8 cut(s) 156, 229, 241, 250, 362, 383, 464, 730
Alw21I GWGCWC 1 cut(s) 231
Alw26I GTCTC 4 cut(s) 178, 273, 680, 855
AlwI GGATC 1 cut(s) 552
AoxI GGCC 4 cut(s) 411, 426, 536, 669
ApeKI GCWGC 4 cut(s) 156, 464, 727, 730
ApoI RAATTY 3 cut(s) 345, 652, 689
AspS9I GGNCC 1 cut(s) 808
AsuHPI GGTGA 4 cut(s) 204, 401, 713, 779
AsuII TTCGAA 1 cut(s) 686
AvaII GGWCC 1 cut(s) 808
BalI TGGCCA 1 cut(s) 671
BanII GRGCYC 1 cut(s) 231
BbsI GAAGAC 1 cut(s) 612
Bbv12I GWGCWC 1 cut(s) 231
BbvI GCAGC 4 cut(s) 143, 451, 717, 739
BccI CCATC 4 cut(s) 102, 258, 517, 607
BcgI CGANNNNNNTGC 2 cut(s) 830, 864
BciT130I CCWGG 3 cut(s) 291, 635, 668
BclI TGATCA 1 cut(s) 529
BcoDI GTCTC 4 cut(s) 178, 273, 680, 855
BfmI CTRYAG 1 cut(s) 157
BglII AGATCT 1 cut(s) 70
BisI GCNGC 4 cut(s) 157, 465, 728, 731
BlsI GCNGC 4 cut(s) 158, 466, 729, 732
Bme1390I CCNGG 3 cut(s) 291, 635, 668
Bme18I GGWCC 1 cut(s) 808
BmgT120I GGNCC 1 cut(s) 808
BmrFI CCNGG 3 cut(s) 291, 635, 668
BmsI GCATC 2 cut(s) 832, 838
BpiI GAAGAC 1 cut(s) 612
BplI GAGNNNNNCTC 2 cut(s) 852, 884
Bpu10I CCTNAGC 2 cut(s) 24, 164
Bpu14I TTCGAA 1 cut(s) 686
BsaBI GATNNNNATC 2 cut(s) 69, 549
BsaI GGTCTC 2 cut(s) 178, 273
BsaJI CCNNGG 2 cut(s) 290, 856
Bsc4I CCNNNNNNNGG 2 cut(s) 509, 667
Bse1I ACTGG 4 cut(s) 326, 672, 820, 869
Bse8I GATNNNNATC 2 cut(s) 69, 549
BseBI CCWGG 3 cut(s) 291, 635, 668
BseDI CCNNGG 2 cut(s) 290, 856
BseGI GGATG 1 cut(s) 532
BseJI GATNNNNATC 2 cut(s) 69, 549
BseLI CCNNNNNNNGG 2 cut(s) 509, 667
BseMII CTCAG 2 cut(s) 326, 694
BseNI ACTGG 4 cut(s) 326, 672, 820, 869
BseRI GAGGAG 1 cut(s) 668
BseXI GCAGC 4 cut(s) 143, 451, 717, 739
BshFI GGCC 4 cut(s) 413, 428, 538, 671
BsiHKAI GWGCWC 1 cut(s) 231
BslI CCNNNNNNNGG 2 cut(s) 509, 667
BsmAI GTCTC 4 cut(s) 178, 273, 680, 855
BsnI GGCC 4 cut(s) 413, 428, 538, 671
Bso31I GGTCTC 2 cut(s) 178, 273
Bsp119I TTCGAA 1 cut(s) 686
Bsp1286I GDGCHC 1 cut(s) 231
Bsp143I GATC 5 cut(s) 70, 529, 544, 562, 787
BspACI CCGC 1 cut(s) 278
BspANI GGCC 4 cut(s) 413, 428, 538, 671
BspCNI CTCAG 2 cut(s) 327, 693
BspMAI CTGCAG 1 cut(s) 161
BspPI GGATC 1 cut(s) 552
BspQI GCTCTTC 2 cut(s) 146, 219
BspT104I TTCGAA 1 cut(s) 686
BspTNI GGTCTC 2 cut(s) 178, 273
BsrI ACTGG 4 cut(s) 326, 672, 820, 869
BssECI CCNNGG 2 cut(s) 290, 856
BssMI GATC 5 cut(s) 70, 529, 544, 562, 787
BssT1I CCWWGG 1 cut(s) 856
Bst2UI CCWGG 3 cut(s) 291, 635, 668
Bst4CI ACNGT 2 cut(s) 498, 808
Bst6I CTCTTC 2 cut(s) 146, 219
BstAPI GCANNNNNTGC 1 cut(s) 53
BstBI TTCGAA 1 cut(s) 686
BstC8I GCNNGC 2 cut(s) 161, 364
BstDEI CTNAG 4 cut(s) 24, 164, 335, 680
BstF5I GGATG 1 cut(s) 532
BstKTI GATC 5 cut(s) 73, 532, 547, 565, 790
BstMAI GTCTC 4 cut(s) 178, 273, 680, 855
BstMBI GATC 5 cut(s) 70, 529, 544, 562, 787
BstMWI GCNNNNNNNGC 4 cut(s) 53, 247, 292, 736
BstNI CCWGG 3 cut(s) 291, 635, 668
BstNSI RCATGY 1 cut(s) 560
BstSCI CCNGG 3 cut(s) 289, 633, 666
BstSFI CTRYAG 1 cut(s) 157
BstV1I GCAGC 4 cut(s) 143, 451, 717, 739
BstV2I GAAGAC 1 cut(s) 612
BstX2I RGATCY 1 cut(s) 70
BstYI RGATCY 1 cut(s) 70
BsuRI GGCC 4 cut(s) 413, 428, 538, 671
BtgZI GCGATG 1 cut(s) 354
BtsCI GGATG 1 cut(s) 532
Cac8I GCNNGC 2 cut(s) 161, 364
Cfr13I GGNCC 1 cut(s) 808
CviAII CATG 4 cut(s) 48, 95, 557, 649
DdeI CTNAG 4 cut(s) 24, 164, 335, 680
DpnI GATC 5 cut(s) 72, 531, 546, 564, 789
DpnII GATC 5 cut(s) 70, 529, 544, 562, 787
EaeI YGGCCR 1 cut(s) 669
Eam1104I CTCTTC 2 cut(s) 146, 219
EarI CTCTTC 2 cut(s) 146, 219
Ecl136II GAGCTC 1 cut(s) 229
Eco130I CCWWGG 1 cut(s) 856
Eco147I AGGCCT 1 cut(s) 538
Eco24I GRGCYC 1 cut(s) 231
Eco31I GGTCTC 2 cut(s) 178, 273
Eco47I GGWCC 1 cut(s) 808
Eco53kI GAGCTC 1 cut(s) 229
Eco57I CTGAAG 1 cut(s) 738
EcoICRI GAGCTC 1 cut(s) 229
EcoRI GAATTC 2 cut(s) 345, 652
EcoRII CCWGG 3 cut(s) 289, 633, 666
EcoT14I CCWWGG 1 cut(s) 856
EcoT38I GRGCYC 1 cut(s) 231
ErhI CCWWGG 1 cut(s) 856
FaeI CATG 4 cut(s) 51, 98, 560, 652
FaiI YATR 8 cut(s) 49, 96, 209, 425, 444, 542, 558, 650
FalI AAGNNNNNCTT 2 cut(s) 17, 49
FatI CATG 4 cut(s) 47, 94, 556, 648
FauI CCCGC 1 cut(s) 271
FbaI TGATCA 1 cut(s) 529
Fnu4HI GCNGC 4 cut(s) 157, 465, 728, 731
FokI GGATG 1 cut(s) 539
FriOI GRGCYC 1 cut(s) 231
Fsp4HI GCNGC 4 cut(s) 157, 465, 728, 731
GluI GCNGC 4 cut(s) 157, 465, 728, 731
HaeIII GGCC 4 cut(s) 413, 428, 538, 671
Hin1II CATG 4 cut(s) 51, 98, 560, 652
HincII GTYRAC 1 cut(s) 784
HindII GTYRAC 1 cut(s) 784
HindIII AAGCTT 1 cut(s) 239
HphI GGTGA 4 cut(s) 204, 401, 713, 779
Hpy166II GTNNAC 1 cut(s) 784
Hpy188I TCNGA 5 cut(s) 75, 336, 628, 658, 718
Hpy188III TCNNGA 4 cut(s) 59, 350, 520, 839
Hpy8I GTNNAC 1 cut(s) 784
HpyAV CCTTC 1 cut(s) 95
HpyCH4III ACNGT 2 cut(s) 498, 808
HpyCH4V TGCA 6 cut(s) 47, 159, 474, 727, 733, 878
HpyF10VI GCNNNNNNNGC 4 cut(s) 53, 247, 292, 736
HpyF3I CTNAG 4 cut(s) 24, 164, 335, 680
Hsp92II CATG 4 cut(s) 51, 98, 560, 652
Ksp22I TGATCA 1 cut(s) 529
Kzo9I GATC 5 cut(s) 70, 529, 544, 562, 787
LguI GCTCTTC 2 cut(s) 146, 219
Lsp1109I GCAGC 4 cut(s) 143, 451, 717, 739
LweI GCATC 2 cut(s) 832, 838
MalI GATC 5 cut(s) 72, 531, 546, 564, 789
MboI GATC 5 cut(s) 70, 529, 544, 562, 787
MboII GAAGA 8 cut(s) 74, 117, 163, 233, 236, 404, 612, 731
MflI RGATCY 1 cut(s) 70
MhlI GDGCHC 1 cut(s) 231
MlsI TGGCCA 1 cut(s) 671
MluCI AATT 5 cut(s) 345, 652, 689, 814, 829
MluNI TGGCCA 1 cut(s) 671
MmeI TCCRAC 2 cut(s) 588, 681
Mox20I TGGCCA 1 cut(s) 671
MscI TGGCCA 1 cut(s) 671
MseI TTAA 1 cut(s) 195
MslI CAYNNNNRTG 1 cut(s) 555
Msp20I TGGCCA 1 cut(s) 671
MspA1I CMGCKG 2 cut(s) 383, 730
MspR9I CCNGG 3 cut(s) 291, 635, 668
MvaI CCWGG 3 cut(s) 291, 635, 668
MwoI GCNNNNNNNGC 4 cut(s) 53, 247, 292, 736
NdeII GATC 5 cut(s) 70, 529, 544, 562, 787
NlaIII CATG 4 cut(s) 51, 98, 560, 652
NspI RCATGY 1 cut(s) 560
NspV TTCGAA 1 cut(s) 686
PceI AGGCCT 1 cut(s) 538
PciI ACATGT 1 cut(s) 556
PciSI GCTCTTC 2 cut(s) 146, 219
PkrI GCNGC 4 cut(s) 158, 466, 729, 732
PscI ACATGT 1 cut(s) 556
Psp124BI GAGCTC 1 cut(s) 231
Psp6I CCWGG 3 cut(s) 289, 633, 666
PspGI CCWGG 3 cut(s) 289, 633, 666
PspPI GGNCC 1 cut(s) 808
PstI CTGCAG 1 cut(s) 161
PsuI RGATCY 1 cut(s) 70
PvuII CAGCTG 2 cut(s) 383, 730
RseI CAYNNNNRTG 1 cut(s) 555
SacI GAGCTC 1 cut(s) 231
SapI GCTCTTC 2 cut(s) 146, 219
SaqAI TTAA 1 cut(s) 195
SatI GCNGC 4 cut(s) 157, 465, 728, 731
Sau3AI GATC 5 cut(s) 70, 529, 544, 562, 787
Sau96I GGNCC 1 cut(s) 808
ScrFI CCNGG 3 cut(s) 291, 635, 668
SduI GDGCHC 1 cut(s) 231
SfaNI GCATC 2 cut(s) 832, 838
SfcI CTRYAG 1 cut(s) 157
SfuI TTCGAA 1 cut(s) 686
SinI GGWCC 1 cut(s) 808
SmiMI CAYNNNNRTG 1 cut(s) 555
Sse9I AATT 5 cut(s) 345, 652, 689, 814, 829
SseBI AGGCCT 1 cut(s) 538
SsiI CCGC 1 cut(s) 278
SspI AATATT 1 cut(s) 743
SstI GAGCTC 1 cut(s) 231
StuI AGGCCT 1 cut(s) 538
StyD4I CCNGG 3 cut(s) 289, 633, 666
StyI CCWWGG 1 cut(s) 856
TaaI ACNGT 2 cut(s) 498, 808
TaqI TCGA 5 cut(s) 60, 568, 686, 840, 870
TasI AATT 5 cut(s) 345, 652, 689, 814, 829
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TseI GCWGC 4 cut(s) 156, 464, 727, 730
TspDTI ATGAA 6 cut(s) 83, 234, 321, 475, 612, 665
VpaK11BI GGWCC 1 cut(s) 808
XapI RAATTY 3 cut(s) 345, 652, 689
XceI RCATGY 1 cut(s) 560
XcmI CCANNNNNNNNNTGG 1 cut(s) 421
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.