Rmu_sc0004472.1_g000006

Belongs to the 'GDSL' lipolytic enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004472.1
OG0017137
Physical Location & Seq
Forward (+)
43686 .. 44365
680 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 579 bp
atggcacatggtgattatatgtattcaatggacttgagtcgtaaatcttcagaatgggtaaagagcaatttggttccagatatcgtccaaaccatcaaagaagctgccacaagggtcattgcttttggtgctgtgaaagtggtcatcccaggaatatacgcatttggttgttttaaagctccaggttataatgtatcgctatgcgaccagggcaaaaatagtgttgcaaccactcacaacgatctgcttcggagagcaattgaggagttaaagaaacaacaccctaatgtgactattgtatatgcagattattacagtgcattcatgtccttcttccccaaggcacttagtctagggtttgaacctgcgaacaagccatgctgtttcggcacacataaaaatggtccaggacatggttttaacccggataacatgtgtggaaagcctggagtacaagcttgtgctaaccctgcgaaacgaatcaactgggatggtagtcatatgacgcaacatgcatacaagttaatagcagatttgataattcctgacatcgcagccaagcttaaatgcagtgcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00901 ko01110 map00901 map01110
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

192

Amino Acids

21.02

Weight (kDa)

8.92

Isoelectric Point (pI)

29.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lipase_GDSL PF00657 12 - 180 4.9e-13 GDSL-like Lipase/Acylhydrolase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017137)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G03980
fragaria_vesca FvH4_4g05740
prunus_persica Prupe.4G256100_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0363081
rosa_laevigata RLG00000027595
rosa_multiflora Rmu_sc0004472.1_g000006
rosa_roxburghii Rroxscaffold_4G00293480
rosa_rugosa Rorug01G0304500
rosa_samantha Rh1AG313500 Rh1BG276700 Rh1CG293400 Rh1DG307400
rosa_wichuraiana Rw1G027770

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 189
Acc36I ACCTGC 1 cut(s) 373
AccB7I CCANNNNNTGG 1 cut(s) 413
AcuI CTGAAG 1 cut(s) 33
AdeI CACNNNGTG 1 cut(s) 11
AfaI GTAC 1 cut(s) 453
AfiI CCNNNNNNNGG 1 cut(s) 413
AflIII ACRYGT 1 cut(s) 432
AgsI TTSAA 2 cut(s) 27, 362
AjnI CCWGG 5 cut(s) 148, 181, 207, 406, 445
AluBI AGCT 4 cut(s) 104, 179, 458, 562
AluI AGCT 4 cut(s) 104, 179, 458, 562
ApeKI GCWGC 2 cut(s) 104, 554
AspS9I GGNCC 1 cut(s) 404
AsuC2I CCSGG 1 cut(s) 425
AsuHPI GGTGA 1 cut(s) 23
AvaII GGWCC 1 cut(s) 404
BbvI GCAGC 2 cut(s) 91, 566
BccI CCATC 2 cut(s) 101, 485
BciT130I CCWGG 5 cut(s) 150, 183, 209, 408, 447
BcnI CCSGG 1 cut(s) 425
BfaI CTAG 1 cut(s) 353
BfuAI ACCTGC 1 cut(s) 373
BisI GCNGC 2 cut(s) 105, 555
BlsI GCNGC 2 cut(s) 106, 556
Bme1390I CCNGG 6 cut(s) 150, 183, 209, 408, 425, 447
Bme18I GGWCC 1 cut(s) 404
BmgT120I GGNCC 1 cut(s) 404
BmiI GGNNCC 1 cut(s) 75
BmrFI CCNGG 6 cut(s) 150, 183, 209, 408, 425, 447
BmrI ACTGGG 1 cut(s) 496
BmuI ACTGGG 1 cut(s) 496
BoxI GACNNNNGTC 1 cut(s) 36
BpmI CTGGAG 2 cut(s) 165, 468
BpuEI CTTGAG 1 cut(s) 55
BpuMI CCSGG 1 cut(s) 425
BsaJI CCNNGG 3 cut(s) 148, 208, 339
Bsc4I CCNNNNNNNGG 1 cut(s) 413
Bse1I ACTGG 1 cut(s) 491
Bse3DI GCAATG 1 cut(s) 117
BseBI CCWGG 5 cut(s) 150, 183, 209, 408, 447
BseDI CCNNGG 3 cut(s) 148, 208, 339
BseGI GGATG 2 cut(s) 144, 496
BseLI CCNNNNNNNGG 1 cut(s) 413
BseMI GCAATG 1 cut(s) 117
BseNI ACTGG 1 cut(s) 491
BseRI GAGGAG 1 cut(s) 278
BseXI GCAGC 2 cut(s) 91, 566
BsiSI CCGG 1 cut(s) 425
BslI CCNNNNNNNGG 1 cut(s) 413
BsmI GAATGC 1 cut(s) 320
Bsp143I GATC 1 cut(s) 241
BspLI GGNNCC 1 cut(s) 75
BspMI ACCTGC 1 cut(s) 373
BsrDI GCAATG 1 cut(s) 117
BsrI ACTGG 1 cut(s) 491
BssECI CCNNGG 3 cut(s) 148, 208, 339
BssMI GATC 1 cut(s) 241
BssT1I CCWWGG 1 cut(s) 339
Bst2UI CCWGG 5 cut(s) 150, 183, 209, 408, 447
Bst4CI ACNGT 1 cut(s) 317
BstDEI CTNAG 1 cut(s) 347
BstF5I GGATG 2 cut(s) 144, 496
BstKTI GATC 1 cut(s) 244
BstMBI GATC 1 cut(s) 241
BstMWI GCNNNNNNNGC 4 cut(s) 128, 210, 387, 470
BstNI CCWGG 5 cut(s) 150, 183, 209, 408, 447
BstNSI RCATGY 2 cut(s) 436, 515
BstPAI GACNNNNGTC 1 cut(s) 36
BstSCI CCNGG 6 cut(s) 148, 181, 207, 406, 423, 445
BstV1I GCAGC 2 cut(s) 91, 566
BtgZI GCGATG 1 cut(s) 535
BtsCI GGATG 2 cut(s) 144, 496
BtsI GCAGTG 1 cut(s) 577
BtsIMutI CAGTG 2 cut(s) 322, 577
BveI ACCTGC 1 cut(s) 373
Cfr13I GGNCC 1 cut(s) 404
CseI GACGC 1 cut(s) 514
Csp6I GTAC 1 cut(s) 452
CviAII CATG 6 cut(s) 8, 325, 378, 413, 433, 512
CviJI RGCY 7 cut(s) 104, 179, 376, 445, 458, 557, 562
CviKI_1 RGCY 7 cut(s) 104, 179, 376, 445, 458, 557, 562
CviQI GTAC 1 cut(s) 452
DdeI CTNAG 1 cut(s) 347
DpnI GATC 1 cut(s) 243
DpnII GATC 1 cut(s) 241
DraI TTTAAA 1 cut(s) 175
DraIII CACNNNGTG 1 cut(s) 11
Eco130I CCWWGG 1 cut(s) 339
Eco32I GATATC 1 cut(s) 82
Eco47I GGWCC 1 cut(s) 404
Eco57I CTGAAG 1 cut(s) 33
EcoRII CCWGG 5 cut(s) 148, 181, 207, 406, 445
EcoRV GATATC 1 cut(s) 82
EcoT14I CCWWGG 1 cut(s) 339
EcoT22I ATGCAT 1 cut(s) 517
ErhI CCWWGG 1 cut(s) 339
FaeI CATG 6 cut(s) 11, 328, 381, 416, 436, 515
FatI CATG 6 cut(s) 7, 324, 377, 412, 432, 511
FauNDI CATATG 1 cut(s) 501
Fnu4HI GCNGC 2 cut(s) 105, 555
FokI GGATG 2 cut(s) 131, 503
Fsp4HI GCNGC 2 cut(s) 105, 555
FspBI CTAG 1 cut(s) 353
GluI GCNGC 2 cut(s) 105, 555
GsuI CTGGAG 2 cut(s) 165, 468
HapII CCGG 1 cut(s) 425
HgaI GACGC 1 cut(s) 514
Hin1II CATG 6 cut(s) 11, 328, 381, 416, 436, 515
HindIII AAGCTT 2 cut(s) 456, 560
HinfI GANTC 2 cut(s) 37, 480
HpaII CCGG 1 cut(s) 425
HphI GGTGA 1 cut(s) 23
Hpy188I TCNGA 2 cut(s) 52, 252
Hpy188III TCNNGA 2 cut(s) 77, 545
HpyAV CCTTC 1 cut(s) 340
HpyCH4III ACNGT 1 cut(s) 317
HpyCH4V TGCA 6 cut(s) 227, 305, 320, 515, 570, 575
HpyF10VI GCNNNNNNNGC 4 cut(s) 128, 210, 387, 470
HpyF3I CTNAG 1 cut(s) 347
Hsp92II CATG 6 cut(s) 11, 328, 381, 416, 436, 515
Kzo9I GATC 1 cut(s) 241
LmnI GCTCC 1 cut(s) 184
Lsp1109I GCAGC 2 cut(s) 91, 566
MaeI CTAG 1 cut(s) 353
MaeIII GTNAC 1 cut(s) 289
MalI GATC 1 cut(s) 243
MboI GATC 1 cut(s) 241
MboII GAAGA 2 cut(s) 39, 325
MfeI CAATTG 1 cut(s) 258
MluCI AATT 3 cut(s) 67, 258, 540
MlyI GAGTC 1 cut(s) 46
MnlI CCTC 1 cut(s) 256
Mph1103I ATGCAT 1 cut(s) 517
MseI TTAA 5 cut(s) 174, 269, 420, 524, 564
MslI CAYNNNNRTG 2 cut(s) 285, 399
MspI CCGG 1 cut(s) 425
MspR9I CCNGG 6 cut(s) 150, 183, 209, 408, 425, 447
MunI CAATTG 1 cut(s) 258
Mva1269I GAATGC 1 cut(s) 320
MvaI CCWGG 5 cut(s) 150, 183, 209, 408, 447
MwoI GCNNNNNNNGC 4 cut(s) 128, 210, 387, 470
NciI CCSGG 1 cut(s) 425
NdeI CATATG 1 cut(s) 501
NdeII GATC 1 cut(s) 241
NlaIII CATG 6 cut(s) 11, 328, 381, 416, 436, 515
NlaIV GGNNCC 1 cut(s) 75
NmuCI GTSAC 1 cut(s) 289
NsiI ATGCAT 1 cut(s) 517
NspI RCATGY 2 cut(s) 436, 515
PciI ACATGT 1 cut(s) 432
PctI GAATGC 1 cut(s) 320
PfeI GAWTC 1 cut(s) 480
PflMI CCANNNNNTGG 1 cut(s) 413
PfoI TCCNGGA 1 cut(s) 406
PkrI GCNGC 2 cut(s) 106, 556
PleI GAGTC 1 cut(s) 45
PpsI GAGTC 1 cut(s) 45
PscI ACATGT 1 cut(s) 432
PshAI GACNNNNGTC 1 cut(s) 36
PsiI TTATAA 1 cut(s) 189
Psp6I CCWGG 5 cut(s) 148, 181, 207, 406, 445
PspGI CCWGG 5 cut(s) 148, 181, 207, 406, 445
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 1 cut(s) 404
RsaI GTAC 1 cut(s) 453
RsaNI GTAC 1 cut(s) 452
RseI CAYNNNNRTG 2 cut(s) 285, 399
SaqAI TTAA 5 cut(s) 174, 269, 420, 524, 564
SatI GCNGC 2 cut(s) 105, 555
Sau3AI GATC 1 cut(s) 241
Sau96I GGNCC 1 cut(s) 404
SchI GAGTC 1 cut(s) 46
ScrFI CCNGG 6 cut(s) 150, 183, 209, 408, 425, 447
SetI ASST 6 cut(s) 106, 181, 187, 367, 460, 564
SinI GGWCC 1 cut(s) 404
SmiMI CAYNNNNRTG 2 cut(s) 285, 399
SmlI CTYRAG 1 cut(s) 34
SmoI CTYRAG 1 cut(s) 34
Sse9I AATT 3 cut(s) 67, 258, 540
SspMI CTAG 1 cut(s) 353
StyD4I CCNGG 6 cut(s) 148, 181, 207, 406, 423, 445
StyI CCWWGG 1 cut(s) 339
TaaI ACNGT 1 cut(s) 317
TasI AATT 3 cut(s) 67, 258, 540
TatI WGTACW 1 cut(s) 451
TfiI GAWTC 1 cut(s) 480
Tru1I TTAA 5 cut(s) 174, 269, 420, 524, 564
Tru9I TTAA 5 cut(s) 174, 269, 420, 524, 564
TscAI CASTG 2 cut(s) 322, 577
TseFI GTSAC 1 cut(s) 289
TseI GCWGC 2 cut(s) 104, 554
Tsp45I GTSAC 1 cut(s) 289
TspDTI ATGAA 1 cut(s) 313
TspRI CASTG 2 cut(s) 322, 577
Van91I CCANNNNNTGG 1 cut(s) 413
VpaK11BI GGWCC 1 cut(s) 404
XceI RCATGY 2 cut(s) 436, 515
XspI CTAG 1 cut(s) 353
Zsp2I ATGCAT 1 cut(s) 517
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.