Rmu_sc0004481.1_g000016

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004481.1
Physical Location & Seq
Forward (+)
67128 .. 68941
1814 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004481.1_g000016.1.cds

Sequence Viewer

Length: 456 bp
atggtggcctcctcgtcttcttcgctgtcgttggactcgtcgtctgggtctcggcgccgtcatcgccgacacaaccgcagccgccgagacaaggataaagaaaaagacaaagatggacatttatcaagaagcagcactgataccaacagtagcctaatattttgctcggaaggatcaatatctcataatattaagcacgccattggagacctgcataatgcgtcacagttaaaatttctactatggctgaatcacctgaataagcagcagaatgagagaaatagcagccctgttcggctttcaaagtttttagggcgtgacaaagatgatggagtgcgtcgcagcgctgtctctggcaaaaagattctgttgaaacttgacaaaacaaaggaggacaaggccgcagaaaacaaacggaatgaattgctgaagttcttgaatgctagtttcgactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

151

Amino Acids

17.13

Weight (kDa)

10.24

Isoelectric Point (pI)

77.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015934)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G27860 AT5G27860
fragaria_vesca FvH4_2g14440
malus_domestica MD10G1017700.v1.1
prunus_persica Prupe.8G021600_v2.0.a1
pyrus_communis pycom10g01140
rosa_chinensis RchiOBHm_Chr6g0276771
rosa_laevigata RLG00000013363
rosa_multiflora Rmu_sc0004481.1_g000016
rosa_roxburghii Rroxscaffold_7G00191980
rosa_rugosa Rorug06G0104100
rosa_samantha Rh6AG214200 Rh6BG219000 Rh6CG221700
rosa_wichuraiana Rw6G018730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 219
AccB1I GGYRCC 1 cut(s) 54
AciI CCGC 3 cut(s) 76, 82, 402
AclWI GGATC 1 cut(s) 181
AcsI RAATTY 1 cut(s) 233
AcuI CTGAAG 1 cut(s) 449
AcyI GRCGYC 1 cut(s) 55
AfeI AGCGCT 1 cut(s) 346
AfiI CCNNNNNNNGG 1 cut(s) 91
AgsI TTSAA 3 cut(s) 303, 373, 439
AhdI GACNNNNNGTC 1 cut(s) 40
Alw26I GTCTC 4 cut(s) 54, 81, 201, 355
AlwI GGATC 1 cut(s) 181
Aor51HI AGCGCT 1 cut(s) 346
AoxI GGCC 2 cut(s) 6, 399
ApeKI GCWGC 5 cut(s) 78, 132, 265, 285, 342
ApoI RAATTY 1 cut(s) 233
AspLEI GCGC 2 cut(s) 57, 347
AsuHPI GGTGA 1 cut(s) 245
BanI GGYRCC 1 cut(s) 54
BbsI GAAGAC 1 cut(s) 9
BbvI GCAGC 5 cut(s) 90, 144, 277, 297, 354
BccI CCATC 2 cut(s) 107, 323
BceAI ACGGC 1 cut(s) 42
BcoDI GTCTC 4 cut(s) 54, 81, 201, 355
BfaI CTAG 1 cut(s) 444
BfoI RGCGCY 2 cut(s) 58, 348
BfuAI ACCTGC 1 cut(s) 219
BisI GCNGC 7 cut(s) 79, 82, 133, 266, 286, 343, 402
BlsI GCNGC 7 cut(s) 80, 83, 134, 267, 287, 344, 403
BmeRI GACNNNNNGTC 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 56
BpiI GAAGAC 1 cut(s) 9
BsaBI GATNNNNATC 1 cut(s) 178
BsaHI GRCGYC 1 cut(s) 55
BsaI GGTCTC 2 cut(s) 54, 201
Bsc4I CCNNNNNNNGG 1 cut(s) 91
Bse8I GATNNNNATC 1 cut(s) 178
BseJI GATNNNNATC 1 cut(s) 178
BseLI CCNNNNNNNGG 1 cut(s) 91
BseXI GCAGC 5 cut(s) 90, 144, 277, 297, 354
BshFI GGCC 2 cut(s) 8, 401
BshNI GGYRCC 1 cut(s) 54
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 4 cut(s) 54, 81, 201, 355
BsmI GAATGC 1 cut(s) 445
BsnI GGCC 2 cut(s) 8, 401
Bso31I GGTCTC 2 cut(s) 54, 201
Bsp143I GATC 1 cut(s) 173
BspACI CCGC 3 cut(s) 76, 82, 402
BspANI GGCC 2 cut(s) 8, 401
BspLI GGNNCC 1 cut(s) 56
BspMI ACCTGC 1 cut(s) 219
BspPI GGATC 1 cut(s) 181
BspT107I GGYRCC 1 cut(s) 54
BspTNI GGTCTC 2 cut(s) 54, 201
BssMI GATC 1 cut(s) 173
BssNI GRCGYC 1 cut(s) 55
Bst4CI ACNGT 2 cut(s) 149, 228
BstACI GRCGYC 1 cut(s) 55
BstC8I GCNNGC 1 cut(s) 198
BstH2I RGCGCY 2 cut(s) 58, 348
BstHHI GCGC 2 cut(s) 57, 347
BstKTI GATC 1 cut(s) 176
BstMAI GTCTC 4 cut(s) 54, 81, 201, 355
BstMBI GATC 1 cut(s) 173
BstMWI GCNNNNNNNGC 1 cut(s) 63
BstV1I GCAGC 5 cut(s) 90, 144, 277, 297, 354
BstV2I GAAGAC 1 cut(s) 9
BsuRI GGCC 2 cut(s) 8, 401
BtgZI GCGATG 1 cut(s) 47
BtsIMutI CAGTG 1 cut(s) 135
BveI ACCTGC 1 cut(s) 219
Cac8I GCNNGC 1 cut(s) 198
CfoI GCGC 2 cut(s) 57, 347
CseI GACGC 2 cut(s) 210, 326
CviJI RGCY 7 cut(s) 8, 81, 153, 247, 288, 298, 401
CviKI_1 RGCY 7 cut(s) 8, 81, 153, 247, 288, 298, 401
DinI GGCGCC 1 cut(s) 56
DpnI GATC 1 cut(s) 175
DpnII GATC 1 cut(s) 173
DriI GACNNNNNGTC 1 cut(s) 40
Eam1105I GACNNNNNGTC 1 cut(s) 40
Eco31I GGTCTC 2 cut(s) 54, 201
Eco47III AGCGCT 1 cut(s) 346
Eco57I CTGAAG 1 cut(s) 449
EgeI GGCGCC 1 cut(s) 56
EheI GGCGCC 1 cut(s) 56
FaiI YATR 3 cut(s) 186, 216, 244
Fnu4HI GCNGC 7 cut(s) 79, 82, 133, 266, 286, 343, 402
Fsp4HI GCNGC 7 cut(s) 79, 82, 133, 266, 286, 343, 402
FspBI CTAG 1 cut(s) 444
GlaI GCGC 2 cut(s) 56, 346
GluI GCNGC 7 cut(s) 79, 82, 133, 266, 286, 343, 402
HaeII RGCGCY 2 cut(s) 58, 348
HaeIII GGCC 2 cut(s) 8, 401
HgaI GACGC 2 cut(s) 210, 326
HhaI GCGC 2 cut(s) 57, 347
Hin1I GRCGYC 1 cut(s) 55
Hin6I GCGC 2 cut(s) 55, 345
HinP1I GCGC 2 cut(s) 55, 345
HinfI GANTC 3 cut(s) 35, 250, 364
HphI GGTGA 1 cut(s) 245
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 2 cut(s) 126, 436
Hpy99I CGWCG 2 cut(s) 43, 342
HpyAV CCTTC 1 cut(s) 164
HpyCH4III ACNGT 2 cut(s) 149, 228
HpyCH4V TGCA 1 cut(s) 214
HpyF10VI GCNNNNNNNGC 1 cut(s) 63
Hsp92I GRCGYC 1 cut(s) 55
HspAI GCGC 2 cut(s) 55, 345
KasI GGCGCC 1 cut(s) 54
Kzo9I GATC 1 cut(s) 173
LpnPI CCDG 5 cut(s) 30, 224, 269, 303, 339
Lsp1109I GCAGC 5 cut(s) 90, 144, 277, 297, 354
MaeI CTAG 1 cut(s) 444
MaeIII GTNAC 2 cut(s) 222, 317
MalI GATC 1 cut(s) 175
MboI GATC 1 cut(s) 173
MboII GAAGA 2 cut(s) 9, 12
MluCI AATT 2 cut(s) 233, 422
Mly113I GGCGCC 1 cut(s) 55
MlyI GAGTC 1 cut(s) 29
MmeI TCCRAC 1 cut(s) 12
MnlI CCTC 3 cut(s) 19, 22, 385
MseI TTAA 2 cut(s) 192, 230
Mva1269I GAATGC 1 cut(s) 445
MwoI GCNNNNNNNGC 1 cut(s) 63
NarI GGCGCC 1 cut(s) 55
NdeII GATC 1 cut(s) 173
NlaIV GGNNCC 1 cut(s) 56
NmeAIII GCCGAG 2 cut(s) 31, 110
NmuCI GTSAC 2 cut(s) 222, 317
PcsI WCGNNNNNNNCGW 1 cut(s) 35
PctI GAATGC 1 cut(s) 445
PfeI GAWTC 2 cut(s) 250, 364
PkrI GCNGC 7 cut(s) 80, 83, 134, 267, 287, 344, 403
PleI GAGTC 1 cut(s) 29
PluTI GGCGCC 1 cut(s) 58
PpsI GAGTC 1 cut(s) 29
PspN4I GGNNCC 1 cut(s) 56
SaqAI TTAA 2 cut(s) 192, 230
SatI GCNGC 7 cut(s) 79, 82, 133, 266, 286, 343, 402
Sau3AI GATC 1 cut(s) 173
SchI GAGTC 1 cut(s) 29
SetI ASST 2 cut(s) 213, 258
SfoI GGCGCC 1 cut(s) 56
Sse9I AATT 2 cut(s) 233, 422
SsiI CCGC 3 cut(s) 76, 82, 402
SspDI GGCGCC 1 cut(s) 54
SspI AATATT 2 cut(s) 159, 190
SspMI CTAG 1 cut(s) 444
TaaI ACNGT 2 cut(s) 149, 228
TaqI TCGA 1 cut(s) 450
TasI AATT 2 cut(s) 233, 422
TauI GCSGC 2 cut(s) 84, 404
TfiI GAWTC 2 cut(s) 250, 364
Tru1I TTAA 2 cut(s) 192, 230
Tru9I TTAA 2 cut(s) 192, 230
TscAI CASTG 1 cut(s) 142
TseFI GTSAC 2 cut(s) 222, 317
TseI GCWGC 5 cut(s) 78, 132, 265, 285, 342
Tsp45I GTSAC 2 cut(s) 222, 317
TspDTI ATGAA 1 cut(s) 435
TspGWI ACGGA 1 cut(s) 430
TspRI CASTG 1 cut(s) 142
XapI RAATTY 1 cut(s) 233
XspI CTAG 1 cut(s) 444
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.