Rmu_sc0004550.1_g000011

RING-type E3 ubiquitin transferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004550.1
Physical Location & Seq
Forward (+)
25922 .. 27991
2070 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004550.1_g000011.1.cds

Sequence Viewer

Length: 2070 bp
atggatgtggctctaattcctccaatgttggtttcttcaggctttttgcctactgggtcattcttagagtcattgattcacatatgcaatgagatttgctccatggaaaagcttccttttcttcaagtcaggaacatctccaccatgataaggaggattaagcttctttcttctttgttcgaagagattcaagaaactaacggccctctccctccatcttcaatcctgtgcctcaccgagctcttctccgtgattcgaagaatcaagtttttgattcaagagtgtaaggactgcagctttttgtggggtcttatgcagatggagctggtttcaaatcagttctacgtgttggtcaaggagttagggagagcacttgatattttgcctgtgagtttgctcaatattacggcagatattagagagcagattgagcttcttcaccggcaagcgaaaagggcagagttgtttattgaccttaaagaggtgaagagaagagaagagcttttggtattgatggggagcaacaatgagaggaacaagaagaacaaagggtttgtagacttgggcaaggtgaaggatatcttgagcagcattggtttgagaagctcaatggattacgaggaagagatttcaaagctagaggcagaagctcaaaagcaagcagggagtggcggactaattgtggtatgcaatataaacaatctcatctcccttgtttcatattgcaaatccatgattttcgtctatgatgatttcgaaacaaccaacaaggaagacttcaagctgctaggttctacaccctcaaatagatattatgatcactcctcatcttctcaatccataattgccaacatcccagatgaatttcgatgcccgatttcactagacttgatgagagatcctgtgatagtagcatcggggcatacatatgatcgaaattccattgctcagtggatcaattcagggcaccaaacatgccccaaaagtggacagaagcttattcacatggcccttatacctaactatgcactgaagagtctattgcatcaatggtgtgaggaaaacaatgttccagaagttggatcatcaccatcatcttcttcagatttggagaggagcaggagcaaaagagattcgtgtgaaaatgctgtggatcacatttctgttgtaaaagcggcagttgatgctgtgaagttaacagctgagtttctggtgggaaaactagcaacaggttcaccagatatccaaagacaagcagcatacgagcttcggttacttgctaaaacaggcatggataacagaagaataatagctgaagcaggagctattcctttcttagtgacattgctgagatcacatgatccaagaattcaggaaaatgctgtcaccgcgctactcaacctttccatcttcaacaacaacaaaattttgataatggctgcaggagcaattgattacataatcgatgtgttggaatcagggaacacaatggaagcaagagagaatgcagcagcagcaattttcagcttgtccattattgatgactgcaaggtgacaattggaaaaagaccaagagccattccggcattggtggggcttttgaaagaaggaactccggctggtaaaaaggacgcagccattgctctcttcaaccttgcagtctacaatgctaacaaggtcagtctggtggttgccggggcggttcccctgctcattgatctgttgatggatgacaaggcggggataacagatgatgccttggcagttcttgctcaacttttgggatgctctgaagggttggaggagattgggaagactagggttctagtgccaattctcattgatcttctgagatttggttctccaaaagggaaggagaattcaataactcttctgttggggttgtgcaaagatggaggagaggaggttgcaagacgactattgatgaacccgcggagtatcccttctcttcaaagcttggttgctgatggatccttgaaagctcgaagaaaagccgatgcactgcttagattactgaacagatgctgctttcaatctcagaatcaatga

Protein Analysis

689

Amino Acids

75.9

Weight (kDa)

6.38

Isoelectric Point (pI)

47.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017717)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g24820
malus_domestica MD01G1156100.v1.1 MD07G1224800.v1.1
prunus_persica Prupe.2G253400_v2.0.a1
pyrus_communis pycom01g17300
rosa_chinensis RchiOBHm_Chr1g0370691
rosa_laevigata RLG00000027017
rosa_multiflora Rmu_sc0004550.1_g000011
rosa_roxburghii Rroxscaffold_4G00286300
rosa_rugosa Rorug01G0358500
rosa_samantha Rh1DG363200
rosa_wichuraiana Rw1G032400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 966
AccB7I CCANNNNNTGG 1 cut(s) 1079
AccI GTMKAC 2 cut(s) 558, 1662
AccII CGCG 2 cut(s) 1391, 1954
AciI CCGC 7 cut(s) 672, 1175, 1389, 1700, 1739, 1952, 1954
AclWI GGATC 7 cut(s) 893, 962, 1090, 1161, 1355, 1986, 1999
AcsI RAATTY 5 cut(s) 863, 937, 1368, 1425, 1879
AcuI CTGAAG 5 cut(s) 21, 1052, 1086, 1335, 1812
AfiI CCNNNNNNNGG 4 cut(s) 150, 481, 986, 1079
AflIII ACRYGT 1 cut(s) 345
AjuI GAANNNNNNNTTGG 2 cut(s) 16, 48
Alw21I GWGCWC 2 cut(s) 243, 373
AlwI GGATC 7 cut(s) 893, 962, 1090, 1161, 1355, 1986, 1999
AlwNI CAGNNNCTG 1 cut(s) 2046
AoxI GGCC 2 cut(s) 202, 1008
ApoI RAATTY 5 cut(s) 863, 937, 1368, 1425, 1879
Asp700I GAANNNNTTC 2 cut(s) 111, 186
AspLEI GCGC 1 cut(s) 1393
AspS9I GGNCC 2 cut(s) 203, 1009
AsuC2I CCSGG 1 cut(s) 1696
AsuHPI GGTGA 8 cut(s) 226, 431, 496, 583, 1080, 1227, 1378, 1564
AsuII TTCGAA 3 cut(s) 180, 256, 756
BaeGI GKGCMC 1 cut(s) 969
BamHI GGATCC 1 cut(s) 1991
BanI GGYRCC 1 cut(s) 966
BanII GRGCYC 1 cut(s) 243
BbsI GAAGAC 2 cut(s) 780, 1820
Bbv12I GWGCWC 2 cut(s) 243, 373
BccI CCATC 8 cut(s) 223, 313, 508, 1099, 1415, 1720, 1907, 1982
BceAI ACGGC 2 cut(s) 217, 423
BciVI GTATCC 1 cut(s) 1970
BclI TGATCA 1 cut(s) 817
BcnI CCSGG 1 cut(s) 1696
BfaI CTAG 6 cut(s) 638, 788, 884, 1223, 1818, 1826
BfmI CTRYAG 2 cut(s) 292, 1440
BfuI GTATCC 1 cut(s) 1970
BglI GCCNNNNNGGC 1 cut(s) 1583
Bme1390I CCNGG 1 cut(s) 1696
BmgT120I GGNCC 2 cut(s) 203, 1009
BmiI GGNNCC 3 cut(s) 968, 1704, 1993
BmrFI CCNGG 1 cut(s) 1696
BmrI ACTGGG 1 cut(s) 63
BmsI GCATC 8 cut(s) 860, 923, 1054, 1174, 1744, 1775, 2008, 2033
BmuI ACTGGG 1 cut(s) 63
BpiI GAAGAC 2 cut(s) 780, 1820
BplI GAGNNNNNCTC 4 cut(s) 83, 115, 230, 262
Bpu14I TTCGAA 3 cut(s) 180, 256, 756
BpuEI CTTGAG 1 cut(s) 604
BpuMI CCSGG 1 cut(s) 1696
Bsa29I ATCGAT 1 cut(s) 1464
BsaAI YACGTR 1 cut(s) 346
BsaJI CCNNGG 4 cut(s) 102, 1695, 1758, 1952
BsaXI ACNNNNNCTCC 2 cut(s) 1911, 1941
Bsc4I CCNNNNNNNGG 4 cut(s) 150, 481, 986, 1079
Bse118I RCCGGY 1 cut(s) 441
Bse1I ACTGG 1 cut(s) 58
Bse3DI GCAATG 4 cut(s) 94, 942, 1343, 1638
BseCI ATCGAT 1 cut(s) 1464
BseDI CCNNGG 4 cut(s) 102, 1695, 1758, 1952
BseGI GGATG 4 cut(s) 10, 852, 1735, 1790
BseLI CCNNNNNNNGG 4 cut(s) 150, 481, 986, 1079
BseMI GCAATG 4 cut(s) 94, 942, 1343, 1638
BseMII CTCAG 4 cut(s) 962, 1194, 1340, 1841
BseNI ACTGG 1 cut(s) 58
BseRI GAGGAG 5 cut(s) 814, 1129, 1817, 1932, 1937
BseSI GKGCMC 1 cut(s) 969
Bsh1236I CGCG 2 cut(s) 1391, 1954
BshFI GGCC 2 cut(s) 204, 1010
BshNI GGYRCC 1 cut(s) 966
BshVI ATCGAT 1 cut(s) 1464
BsiHKAI GWGCWC 2 cut(s) 243, 373
BsiSI CCGG 4 cut(s) 442, 1583, 1616, 1695
BslI CCNNNNNNNGG 4 cut(s) 150, 481, 986, 1079
BsmI GAATGC 1 cut(s) 1510
BsnI GGCC 2 cut(s) 204, 1010
Bsp119I TTCGAA 3 cut(s) 180, 256, 756
Bsp1286I GDGCHC 3 cut(s) 243, 373, 969
Bsp19I CCATGG 1 cut(s) 102
BspACI CCGC 7 cut(s) 672, 1175, 1389, 1700, 1739, 1952, 1954
BspANI GGCC 2 cut(s) 204, 1010
BspCNI CTCAG 4 cut(s) 961, 1195, 1341, 1842
BspDI ATCGAT 1 cut(s) 1464
BspFNI CGCG 2 cut(s) 1391, 1954
BspLI GGNNCC 3 cut(s) 968, 1704, 1993
BspMAI CTGCAG 2 cut(s) 296, 1444
BspPI GGATC 7 cut(s) 893, 962, 1090, 1161, 1355, 1986, 1999
BspQI GCTCTTC 2 cut(s) 248, 492
BspT104I TTCGAA 3 cut(s) 180, 256, 756
BspT107I GGYRCC 1 cut(s) 966
BsrDI GCAATG 4 cut(s) 94, 942, 1343, 1638
BsrFI RCCGGY 1 cut(s) 441
BsrI ACTGG 1 cut(s) 58
BssAI RCCGGY 1 cut(s) 441
BssECI CCNNGG 4 cut(s) 102, 1695, 1758, 1952
BssT1I CCWWGG 2 cut(s) 102, 1758
BstAPI GCANNNNNTGC 3 cut(s) 1184, 1640, 1769
BstBAI YACGTR 1 cut(s) 346
BstBI TTCGAA 3 cut(s) 180, 256, 756
BstC8I GCNNGC 2 cut(s) 447, 660
BstDEI CTNAG 8 cut(s) 64, 948, 1203, 1336, 1349, 1850, 2027, 2058
BstDSI CCRYGG 2 cut(s) 102, 1952
BstENI CCTNNNNNAGG 1 cut(s) 479
BstF5I GGATG 4 cut(s) 10, 852, 1735, 1790
BstFNI CGCG 2 cut(s) 1391, 1954
BstHHI GCGC 1 cut(s) 1393
BstNSI RCATGY 1 cut(s) 978
BstSCI CCNGG 1 cut(s) 1694
BstSFI CTRYAG 2 cut(s) 292, 1440
BstSLI GKGCMC 1 cut(s) 969
BstUI CGCG 2 cut(s) 1391, 1954
BstV2I GAAGAC 2 cut(s) 780, 1820
BstX2I RGATCY 2 cut(s) 898, 1991
BstYI RGATCY 2 cut(s) 898, 1991
Bsu15I ATCGAT 1 cut(s) 1464
BsuI GTATCC 1 cut(s) 1970
BsuRI GGCC 2 cut(s) 204, 1010
BsuTUI ATCGAT 1 cut(s) 1464
BtgI CCRYGG 2 cut(s) 102, 1952
BtsCI GGATG 4 cut(s) 10, 852, 1735, 1790
BtsI GCAGTG 1 cut(s) 2021
BtsIMutI CAGTG 3 cut(s) 956, 1028, 2021
Cac8I GCNNGC 2 cut(s) 447, 660
CaiI CAGNNNCTG 1 cut(s) 2046
CfoI GCGC 1 cut(s) 1393
Cfr10I RCCGGY 1 cut(s) 441
Cfr13I GGNCC 2 cut(s) 203, 1009
Cfr42I CCGCGG 1 cut(s) 1955
ClaI ATCGAT 1 cut(s) 1464
CseI GACGC 1 cut(s) 1640
CviAII CATG 7 cut(s) 103, 145, 733, 975, 1006, 1291, 1358
DdeI CTNAG 8 cut(s) 64, 948, 1203, 1336, 1349, 1850, 2027, 2058
EciI GGCGGA 1 cut(s) 687
Ecl136II GAGCTC 1 cut(s) 241
Eco130I CCWWGG 2 cut(s) 102, 1758
Eco24I GRGCYC 1 cut(s) 243
Eco32I GATATC 2 cut(s) 580, 1243
Eco53kI GAGCTC 1 cut(s) 241
Eco57I CTGAAG 5 cut(s) 21, 1052, 1086, 1335, 1812
EcoICRI GAGCTC 1 cut(s) 241
EcoNI CCTNNNNNAGG 1 cut(s) 479
EcoRI GAATTC 2 cut(s) 1368, 1879
EcoRV GATATC 2 cut(s) 580, 1243
EcoT14I CCWWGG 2 cut(s) 102, 1758
EcoT38I GRGCYC 1 cut(s) 243
ErhI CCWWGG 2 cut(s) 102, 1758
FaeI CATG 7 cut(s) 106, 148, 736, 978, 1009, 1294, 1361
FalI AAGNNNNNCTT 4 cut(s) 566, 598, 761, 793
FatI CATG 7 cut(s) 102, 144, 732, 974, 1005, 1290, 1357
FauI CCCGC 2 cut(s) 1732, 1959
FauNDI CATATG 2 cut(s) 83, 928
FbaI TGATCA 1 cut(s) 817
FblI GTMKAC 2 cut(s) 558, 1662
FokI GGATG 4 cut(s) 17, 839, 1742, 1797
FriOI GRGCYC 1 cut(s) 243
FspBI CTAG 6 cut(s) 638, 788, 884, 1223, 1818, 1826
GlaI GCGC 1 cut(s) 1392
HaeIII GGCC 2 cut(s) 204, 1010
HapII CCGG 4 cut(s) 442, 1583, 1616, 1695
HgaI GACGC 1 cut(s) 1640
HhaI GCGC 1 cut(s) 1393
Hin1II CATG 7 cut(s) 106, 148, 736, 978, 1009, 1294, 1361
Hin6I GCGC 1 cut(s) 1391
HinP1I GCGC 1 cut(s) 1391
HincII GTYRAC 1 cut(s) 1197
HindII GTYRAC 1 cut(s) 1197
HindIII AAGCTT 4 cut(s) 110, 161, 995, 1975
HpaI GTTAAC 1 cut(s) 1197
HpaII CCGG 4 cut(s) 442, 1583, 1616, 1695
HphI GGTGA 8 cut(s) 226, 431, 496, 583, 1080, 1227, 1378, 1564
Hpy166II GTNNAC 5 cut(s) 559, 989, 1197, 1235, 1663
Hpy188I TCNGA 4 cut(s) 1105, 1792, 1851, 2061
Hpy188III TCNNGA 6 cut(s) 130, 191, 278, 583, 1073, 1373
Hpy8I GTNNAC 5 cut(s) 559, 989, 1197, 1235, 1663
HpyAV CCTTC 5 cut(s) 568, 1601, 1787, 1867, 1974
HpyCH4IV ACGT 1 cut(s) 345
HpyF3I CTNAG 8 cut(s) 64, 948, 1203, 1336, 1349, 1850, 2027, 2058
HpySE526I ACGT 1 cut(s) 345
Hsp92II CATG 7 cut(s) 106, 148, 736, 978, 1009, 1294, 1361
HspAI GCGC 1 cut(s) 1391
Ksp22I TGATCA 1 cut(s) 817
KspAI GTTAAC 1 cut(s) 1197
KspI CCGCGG 1 cut(s) 1955
LguI GCTCTTC 2 cut(s) 248, 492
LmnI GCTCC 7 cut(s) 104, 322, 519, 1116, 1122, 1322, 1445
LweI GCATC 8 cut(s) 860, 923, 1054, 1174, 1744, 1775, 2008, 2033
MaeI CTAG 6 cut(s) 638, 788, 884, 1223, 1818, 1826
MaeII ACGT 1 cut(s) 345
MaeIII GTNAC 4 cut(s) 1272, 1339, 1384, 1552
MfeI CAATTG 2 cut(s) 1449, 1557
MflI RGATCY 2 cut(s) 898, 1991
MhlI GDGCHC 3 cut(s) 243, 373, 969
MlyI GAGTC 2 cut(s) 77, 1045
MmeI TCCRAC 3 cut(s) 1060, 1452, 1779
MroXI GAANNNNTTC 2 cut(s) 111, 186
MseI TTAA 3 cut(s) 159, 477, 1196
MslI CAYNNNNRTG 1 cut(s) 927
MspA1I CMGCKG 2 cut(s) 1202, 1954
MspI CCGG 4 cut(s) 442, 1583, 1616, 1695
MspR9I CCNGG 1 cut(s) 1696
MunI CAATTG 2 cut(s) 1449, 1557
Mva1269I GAATGC 1 cut(s) 1510
MvnI CGCG 2 cut(s) 1391, 1954
NciI CCSGG 1 cut(s) 1696
NcoI CCATGG 1 cut(s) 102
NdeI CATATG 2 cut(s) 83, 928
NlaIII CATG 7 cut(s) 106, 148, 736, 978, 1009, 1294, 1361
NlaIV GGNNCC 3 cut(s) 968, 1704, 1993
NmuCI GTSAC 3 cut(s) 1339, 1384, 1552
NspI RCATGY 1 cut(s) 978
NspV TTCGAA 3 cut(s) 180, 256, 756
PciSI GCTCTTC 2 cut(s) 248, 492
PctI GAATGC 1 cut(s) 1510
PdmI GAANNNNTTC 2 cut(s) 111, 186
PfeI GAWTC 8 cut(s) 76, 187, 253, 261, 274, 1133, 1475, 2062
PflMI CCANNNNNTGG 1 cut(s) 1079
PleI GAGTC 2 cut(s) 76, 1044
PpsI GAGTC 2 cut(s) 76, 1044
Ppu21I YACGTR 1 cut(s) 346
Psp124BI GAGCTC 1 cut(s) 243
PspN4I GGNNCC 3 cut(s) 968, 1704, 1993
PspPI GGNCC 2 cut(s) 203, 1009
PstI CTGCAG 2 cut(s) 296, 1444
PstNI CAGNNNCTG 1 cut(s) 2046
PsuI RGATCY 2 cut(s) 898, 1991
PvuII CAGCTG 1 cut(s) 1202
RseI CAYNNNNRTG 1 cut(s) 927
SacI GAGCTC 1 cut(s) 243
SacII CCGCGG 1 cut(s) 1955
SapI GCTCTTC 2 cut(s) 248, 492
SaqAI TTAA 3 cut(s) 159, 477, 1196
Sau96I GGNCC 2 cut(s) 203, 1009
SchI GAGTC 2 cut(s) 77, 1045
ScrFI CCNGG 1 cut(s) 1696
SduI GDGCHC 3 cut(s) 243, 373, 969
SfaNI GCATC 8 cut(s) 860, 923, 1054, 1174, 1744, 1775, 2008, 2033
SfcI CTRYAG 2 cut(s) 292, 1440
Sfr303I CCGCGG 1 cut(s) 1955
SfuI TTCGAA 3 cut(s) 180, 256, 756
SgrBI CCGCGG 1 cut(s) 1955
SmiMI CAYNNNNRTG 1 cut(s) 927
SmlI CTYRAG 1 cut(s) 583
SmoI CTYRAG 1 cut(s) 583
SsiI CCGC 7 cut(s) 672, 1175, 1389, 1700, 1739, 1952, 1954
SspI AATATT 1 cut(s) 403
SspMI CTAG 6 cut(s) 638, 788, 884, 1223, 1818, 1826
SstI GAGCTC 1 cut(s) 243
StyD4I CCNGG 1 cut(s) 1694
StyI CCWWGG 2 cut(s) 102, 1758
TaiI ACGT 1 cut(s) 348
TaqI TCGA 7 cut(s) 180, 256, 756, 868, 934, 1464, 2005
TauI GCSGC 1 cut(s) 1178
TfiI GAWTC 8 cut(s) 76, 187, 253, 261, 274, 1133, 1475, 2062
Tru1I TTAA 3 cut(s) 159, 477, 1196
Tru9I TTAA 3 cut(s) 159, 477, 1196
TscAI CASTG 3 cut(s) 956, 1035, 2028
TseFI GTSAC 3 cut(s) 1339, 1384, 1552
Tsp45I GTSAC 3 cut(s) 1339, 1384, 1552
TspDTI ATGAA 3 cut(s) 708, 876, 1961
TspGWI ACGGA 1 cut(s) 238
TspRI CASTG 3 cut(s) 956, 1035, 2028
Van91I CCANNNNNTGG 1 cut(s) 1079
XagI CCTNNNNNAGG 1 cut(s) 479
XapI RAATTY 5 cut(s) 863, 937, 1368, 1425, 1879
XceI RCATGY 1 cut(s) 978
XcmI CCANNNNNNNNNTGG 1 cut(s) 1585
XmiI GTMKAC 2 cut(s) 558, 1662
XmnI GAANNNNTTC 2 cut(s) 111, 186
XspI CTAG 6 cut(s) 638, 788, 884, 1223, 1818, 1826
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.