Rmu_sc0004736.1_g000021

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004736.1
Physical Location & Seq
Reverse (-)
94375 .. 95085
711 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004736.1_g000021.1.cds

Sequence Viewer

Length: 711 bp
atgacgctccacgttcagtctagaattcccgtatacttggtattacaagtgccagtcaagcccgatattacaatgacagtcgaaagcccttctggcccattatatccaactaacgaagtagagttcagacccaaaaaagaccacaacactgtcttccttatttcgttctcattttgctggaaaagtttgatgagcaggaaaaccgaaaacatgttacggtttgctgctctctcactgcccgcattccaattcccataccctttaaattccacaacaatacctctatctattcccgcccaacaatatacccacctcaattctttctcttcttcttcgctcctcaaaacccaaacccaaatccccaaaagacccatcagattcgtagcgctcgcaaacaacaacaacaacaatggtttgaaccaggagaaggaagaggagaaagagaaagaacaaggaattgggtccaacggcggcggagatgggtcggggaagaatcagcggtctatattcagcaacatcaggtggggcgatctgctgctggacccagatcctaacaacatcttggccgtcggattgacggggatactgacatgggcaagcgtgcaggttctgtggcagctcttgttcatctcgttggctatactcgttgctgctgttaagtattccttcattgctgctgttcttcttttcattctcattacccttctttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

236

Amino Acids

26.3

Weight (kDa)

9.21

Isoelectric Point (pI)

43.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014933)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 595
AccI GTMKAC 1 cut(s) 33
AciI CCGC 5 cut(s) 240, 294, 471, 474, 499
AclWI GGATC 1 cut(s) 542
AcoI YGGCCR 1 cut(s) 564
AcsI RAATTY 2 cut(s) 24, 265
AfeI AGCGCT 1 cut(s) 387
AfiI CCNNNNNNNGG 1 cut(s) 427
AflIII ACRYGT 1 cut(s) 210
AgsI TTSAA 1 cut(s) 418
AjnI CCWGG 1 cut(s) 420
AjuI GAANNNNNNNTTGG 2 cut(s) 441, 473
AluBI AGCT 1 cut(s) 619
AluI AGCT 1 cut(s) 619
AlwI GGATC 1 cut(s) 542
AlwNI CAGNNNCTG 1 cut(s) 610
Aor51HI AGCGCT 1 cut(s) 387
AoxI GGCC 2 cut(s) 94, 564
ApeKI GCWGC 5 cut(s) 224, 535, 616, 650, 674
ApoI RAATTY 2 cut(s) 24, 265
AspLEI GCGC 1 cut(s) 388
AspS9I GGNCC 3 cut(s) 95, 462, 541
AvaII GGWCC 2 cut(s) 462, 541
BbsI GAAGAC 1 cut(s) 145
BbvI GCAGC 5 cut(s) 211, 522, 628, 637, 661
BccI CCATC 2 cut(s) 380, 473
BceAI ACGGC 2 cut(s) 484, 551
BciT130I CCWGG 1 cut(s) 422
BciVI GTATCC 1 cut(s) 576
BfaI CTAG 1 cut(s) 21
BfoI RGCGCY 1 cut(s) 389
BfuAI ACCTGC 1 cut(s) 595
BfuI GTATCC 1 cut(s) 576
BglI GCCNNNNNGGC 1 cut(s) 93
BisI GCNGC 6 cut(s) 225, 472, 536, 617, 651, 675
BlsI GCNGC 6 cut(s) 226, 473, 537, 618, 652, 676
Bme1390I CCNGG 1 cut(s) 422
Bme18I GGWCC 2 cut(s) 462, 541
BmgT120I GGNCC 3 cut(s) 95, 462, 541
BmiI GGNNCC 2 cut(s) 463, 543
BmrFI CCNGG 1 cut(s) 422
BpiI GAAGAC 1 cut(s) 145
Bsc4I CCNNNNNNNGG 1 cut(s) 427
Bse1I ACTGG 1 cut(s) 53
Bse3DI GCAATG 1 cut(s) 669
BseBI CCWGG 1 cut(s) 422
BseLI CCNNNNNNNGG 1 cut(s) 427
BseMI GCAATG 1 cut(s) 669
BseNI ACTGG 1 cut(s) 53
BseRI GAGGAG 2 cut(s) 329, 449
BseXI GCAGC 5 cut(s) 211, 522, 628, 637, 661
BsgI GTGCAG 1 cut(s) 623
BshFI GGCC 2 cut(s) 96, 566
BslI CCNNNNNNNGG 1 cut(s) 427
BsmI GAATGC 1 cut(s) 242
BsnI GGCC 2 cut(s) 96, 566
Bsp143I GATC 2 cut(s) 529, 547
BspACI CCGC 5 cut(s) 240, 294, 471, 474, 499
BspANI GGCC 2 cut(s) 96, 566
BspLI GGNNCC 2 cut(s) 463, 543
BspMI ACCTGC 1 cut(s) 595
BspPI GGATC 1 cut(s) 542
BsrDI GCAATG 1 cut(s) 669
BsrI ACTGG 1 cut(s) 53
BssMI GATC 2 cut(s) 529, 547
BssNAI GTATAC 1 cut(s) 34
Bst1107I GTATAC 1 cut(s) 34
Bst2UI CCWGG 1 cut(s) 422
Bst4CI ACNGT 3 cut(s) 79, 151, 219
Bst6I CTCTTC 2 cut(s) 331, 426
BstC8I GCNNGC 4 cut(s) 240, 390, 598, 602
BstH2I RGCGCY 1 cut(s) 389
BstHHI GCGC 1 cut(s) 388
BstKTI GATC 2 cut(s) 532, 550
BstMBI GATC 2 cut(s) 529, 547
BstMWI GCNNNNNNNGC 2 cut(s) 58, 93
BstNI CCWGG 1 cut(s) 422
BstNSI RCATGY 1 cut(s) 214
BstSCI CCNGG 1 cut(s) 420
BstV1I GCAGC 5 cut(s) 211, 522, 628, 637, 661
BstV2I GAAGAC 1 cut(s) 145
BstX2I RGATCY 1 cut(s) 547
BstYI RGATCY 1 cut(s) 547
BstZ17I GTATAC 1 cut(s) 34
BsuI GTATCC 1 cut(s) 576
BsuRI GGCC 2 cut(s) 96, 566
BtsI GCAGTG 1 cut(s) 233
BtsIMutI CAGTG 2 cut(s) 147, 233
BveI ACCTGC 1 cut(s) 595
Cac8I GCNNGC 4 cut(s) 240, 390, 598, 602
CaiI CAGNNNCTG 1 cut(s) 610
CfoI GCGC 1 cut(s) 388
Cfr13I GGNCC 3 cut(s) 95, 462, 541
CseI GACGC 1 cut(s) 13
CviAII CATG 2 cut(s) 211, 591
CviJI RGCY 6 cut(s) 61, 87, 96, 566, 619, 638
CviKI_1 RGCY 6 cut(s) 61, 87, 96, 566, 619, 638
DpnI GATC 2 cut(s) 531, 549
DpnII GATC 2 cut(s) 529, 547
DraI TTTAAA 1 cut(s) 264
EaeI YGGCCR 1 cut(s) 564
Eam1104I CTCTTC 2 cut(s) 331, 426
EarI CTCTTC 2 cut(s) 331, 426
EciI GGCGGA 1 cut(s) 489
Eco47I GGWCC 2 cut(s) 462, 541
Eco47III AGCGCT 1 cut(s) 387
EcoRI GAATTC 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 420
FaeI CATG 2 cut(s) 214, 594
FaiI YATR 8 cut(s) 34, 103, 212, 256, 306, 506, 592, 641
FalI AAGNNNNNCTT 2 cut(s) 650, 682
FatI CATG 2 cut(s) 210, 590
FauI CCCGC 2 cut(s) 247, 301
FblI GTMKAC 1 cut(s) 33
Fnu4HI GCNGC 6 cut(s) 225, 472, 536, 617, 651, 675
Fsp4HI GCNGC 6 cut(s) 225, 472, 536, 617, 651, 675
FspBI CTAG 1 cut(s) 21
GlaI GCGC 1 cut(s) 387
GluI GCNGC 6 cut(s) 225, 472, 536, 617, 651, 675
HaeII RGCGCY 1 cut(s) 389
HaeIII GGCC 2 cut(s) 96, 566
HgaI GACGC 1 cut(s) 13
HhaI GCGC 1 cut(s) 388
Hin1II CATG 2 cut(s) 214, 594
Hin6I GCGC 1 cut(s) 386
HinP1I GCGC 1 cut(s) 386
HinfI GANTC 2 cut(s) 378, 493
Hpy166II GTNNAC 1 cut(s) 34
Hpy188I TCNGA 3 cut(s) 128, 377, 572
Hpy188III TCNNGA 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 34
Hpy99I CGWCG 1 cut(s) 572
HpyAV CCTTC 3 cut(s) 99, 421, 676
HpyCH4III ACNGT 3 cut(s) 79, 151, 219
HpyCH4IV ACGT 1 cut(s) 12
HpyCH4V TGCA 1 cut(s) 604
HpyF10VI GCNNNNNNNGC 2 cut(s) 58, 93
HpySE526I ACGT 1 cut(s) 12
Hsp92II CATG 2 cut(s) 214, 594
HspAI GCGC 1 cut(s) 386
Kzo9I GATC 2 cut(s) 529, 547
LmnI GCTCC 2 cut(s) 12, 342
Lsp1109I GCAGC 5 cut(s) 211, 522, 628, 637, 661
MaeI CTAG 1 cut(s) 21
MaeII ACGT 1 cut(s) 12
MaeIII GTNAC 1 cut(s) 213
MalI GATC 2 cut(s) 531, 549
MboI GATC 2 cut(s) 529, 547
MboII GAAGA 7 cut(s) 145, 318, 321, 324, 443, 502, 674
MflI RGATCY 1 cut(s) 547
MluCI AATT 5 cut(s) 24, 248, 265, 316, 456
MmeI TCCRAC 3 cut(s) 131, 489, 550
MnlI CCTC 4 cut(s) 291, 323, 350, 427
MseI TTAA 3 cut(s) 263, 657, 709
MspA1I CMGCKG 1 cut(s) 499
MspR9I CCNGG 1 cut(s) 422
Mva1269I GAATGC 1 cut(s) 242
MvaI CCWGG 1 cut(s) 422
MwoI GCNNNNNNNGC 2 cut(s) 58, 93
NdeII GATC 2 cut(s) 529, 547
NlaIII CATG 2 cut(s) 214, 594
NlaIV GGNNCC 2 cut(s) 463, 543
NspI RCATGY 1 cut(s) 214
PciI ACATGT 1 cut(s) 210
PctI GAATGC 1 cut(s) 242
PfeI GAWTC 2 cut(s) 378, 493
PkrI GCNGC 6 cut(s) 226, 473, 537, 618, 652, 676
PscI ACATGT 1 cut(s) 210
Psp6I CCWGG 1 cut(s) 420
PspGI CCWGG 1 cut(s) 420
PspN4I GGNNCC 2 cut(s) 463, 543
PspPI GGNCC 3 cut(s) 95, 462, 541
PstNI CAGNNNCTG 1 cut(s) 610
PsuI RGATCY 1 cut(s) 547
SaqAI TTAA 3 cut(s) 263, 657, 709
SatI GCNGC 6 cut(s) 225, 472, 536, 617, 651, 675
Sau3AI GATC 2 cut(s) 529, 547
Sau96I GGNCC 3 cut(s) 95, 462, 541
ScrFI CCNGG 1 cut(s) 422
SetI ASST 6 cut(s) 15, 283, 315, 524, 609, 621
SinI GGWCC 2 cut(s) 462, 541
Sse9I AATT 5 cut(s) 24, 248, 265, 316, 456
SsiI CCGC 5 cut(s) 240, 294, 471, 474, 499
SspMI CTAG 1 cut(s) 21
StyD4I CCNGG 1 cut(s) 420
TaaI ACNGT 3 cut(s) 79, 151, 219
TaiI ACGT 1 cut(s) 15
TaqI TCGA 1 cut(s) 81
TasI AATT 5 cut(s) 24, 248, 265, 316, 456
TauI GCSGC 1 cut(s) 474
TfiI GAWTC 2 cut(s) 378, 493
Tru1I TTAA 3 cut(s) 263, 657, 709
Tru9I TTAA 3 cut(s) 263, 657, 709
TscAI CASTG 2 cut(s) 154, 240
TseI GCWGC 5 cut(s) 224, 535, 616, 650, 674
TspDTI ATGAA 3 cut(s) 616, 658, 679
TspRI CASTG 2 cut(s) 154, 240
VpaK11BI GGWCC 2 cut(s) 462, 541
XapI RAATTY 2 cut(s) 24, 265
XbaI TCTAGA 1 cut(s) 20
XceI RCATGY 1 cut(s) 214
XmiI GTMKAC 1 cut(s) 33
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.