Rmu_sc0005120.1_g000006

auxin-induced protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005120.1
Physical Location & Seq
Forward (+)
24047 .. 24382
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005120.1_g000006.1.cds

Sequence Viewer

Length: 336 bp
atggcgatcatcaaaaaatcattatcaaacaaagcattgctagtgcctcaaacggcagcgctgaagcaaattctcaagaggtgctcgagtttcgggaagaaaaacaatggctacaatgtaagtggtctccccgatgatattccgaaagggcattttgctgtgtacgtaggcgaaaacagaagccgatacataatccctatttcgtggttgggcaatccggagtttcagagcttgctgcagagggctgaggaggagttcgggtttaaccctgacatgggtttaacgattccttgcgaagaagtcgtctttcgctccctgatagatcagtattgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.47

Weight (kDa)

8.47

Isoelectric Point (pI)

40.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015844)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G16580 AT4G34760 AT4G36110
fragaria_vesca FvH4_1g11980
malus_domestica MD02G1133900.v1.1 MD15G1246800.v1.1
prunus_persica Prupe.7G167000_v2.0.a1
pyrus_communis pycom02g10550
rosa_chinensis RchiOBHm_Chr2g0099601
rosa_laevigata RLG00000016895
rosa_multiflora Rmu_sc0005120.1_g000006
rosa_roxburghii Rroxscaffold_2G00142940
rosa_rugosa Rorug02G0081400
rosa_samantha Rh2DG135200
rosa_wichuraiana Rw2G010100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 217
AcsI RAATTY 1 cut(s) 69
AcuI CTGAAG 1 cut(s) 83
AfaI GTAC 1 cut(s) 164
AfeI AGCGCT 1 cut(s) 60
AfiI CCNNNNNNNGG 2 cut(s) 274, 275
AluBI AGCT 1 cut(s) 231
AluI AGCT 1 cut(s) 231
Alw21I GWGCWC 1 cut(s) 86
Alw26I GTCTC 1 cut(s) 131
Ama87I CYCGRG 1 cut(s) 85
Aor13HI TCCGGA 1 cut(s) 217
Aor51HI AGCGCT 1 cut(s) 60
ApeKI GCWGC 2 cut(s) 56, 235
ApoI RAATTY 1 cut(s) 69
ArsI GACNNNNNNTTYG 2 cut(s) 288, 320
AspLEI GCGC 1 cut(s) 61
AvaI CYCGRG 1 cut(s) 85
Bbv12I GWGCWC 1 cut(s) 86
BbvCI CCTCAGC 1 cut(s) 246
BbvI GCAGC 2 cut(s) 68, 222
BceAI ACGGC 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 131
BfaI CTAG 1 cut(s) 41
BfmI CTRYAG 1 cut(s) 236
BfoI RGCGCY 1 cut(s) 62
BisI GCNGC 2 cut(s) 57, 236
BlsI GCNGC 2 cut(s) 58, 237
BmeT110I CYCGRG 1 cut(s) 85
Bpu10I CCTNAGC 1 cut(s) 246
BpuEI CTTGAG 1 cut(s) 59
BsaAI YACGTR 1 cut(s) 166
BsaI GGTCTC 1 cut(s) 131
BsaWI WCCGGW 1 cut(s) 217
BsaXI ACNNNNNCTCC 2 cut(s) 245, 275
Bsc4I CCNNNNNNNGG 2 cut(s) 274, 275
Bse3DI GCAATG 1 cut(s) 35
BseAI TCCGGA 1 cut(s) 217
BseLI CCNNNNNNNGG 2 cut(s) 274, 275
BseMI GCAATG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 237
BseRI GAGGAG 2 cut(s) 263, 266
BseXI GCAGC 2 cut(s) 68, 222
BsiHKAI GWGCWC 1 cut(s) 86
BsiHKCI CYCGRG 1 cut(s) 85
BsiSI CCGG 1 cut(s) 218
BslI CCNNNNNNNGG 2 cut(s) 274, 275
BsmAI GTCTC 1 cut(s) 131
Bso31I GGTCTC 1 cut(s) 131
BsoBI CYCGRG 1 cut(s) 85
Bsp1286I GDGCHC 1 cut(s) 86
Bsp13I TCCGGA 1 cut(s) 217
Bsp143I GATC 2 cut(s) 6, 322
BspCNI CTCAG 1 cut(s) 238
BspEI TCCGGA 1 cut(s) 217
BspMAI CTGCAG 1 cut(s) 240
BspTNI GGTCTC 1 cut(s) 131
BsrDI GCAATG 1 cut(s) 35
BssMI GATC 2 cut(s) 6, 322
BstBAI YACGTR 1 cut(s) 166
BstC8I GCNNGC 1 cut(s) 233
BstDEI CTNAG 1 cut(s) 246
BstH2I RGCGCY 1 cut(s) 62
BstHHI GCGC 1 cut(s) 61
BstKTI GATC 2 cut(s) 9, 325
BstMAI GTCTC 1 cut(s) 131
BstMBI GATC 2 cut(s) 6, 322
BstSFI CTRYAG 1 cut(s) 236
BstSNI TACGTA 1 cut(s) 166
BstV1I GCAGC 2 cut(s) 68, 222
Cac8I GCNNGC 1 cut(s) 233
CfoI GCGC 1 cut(s) 61
Csp6I GTAC 1 cut(s) 163
CspCI CAANNNNNGTGG 2 cut(s) 103, 138
CviAII CATG 1 cut(s) 274
CviJI RGCY 4 cut(s) 111, 183, 231, 245
CviKI_1 RGCY 4 cut(s) 111, 183, 231, 245
CviQI GTAC 1 cut(s) 163
DdeI CTNAG 1 cut(s) 246
DpnI GATC 2 cut(s) 8, 324
DpnII GATC 2 cut(s) 6, 322
Eco105I TACGTA 1 cut(s) 166
Eco31I GGTCTC 1 cut(s) 131
Eco47III AGCGCT 1 cut(s) 60
Eco57I CTGAAG 1 cut(s) 83
Eco88I CYCGRG 1 cut(s) 85
FaeI CATG 1 cut(s) 277
FaiI YATR 2 cut(s) 191, 275
FatI CATG 1 cut(s) 273
Fnu4HI GCNGC 2 cut(s) 57, 236
Fsp4HI GCNGC 2 cut(s) 57, 236
FspBI CTAG 1 cut(s) 41
GlaI GCGC 1 cut(s) 60
GluI GCNGC 2 cut(s) 57, 236
HaeII RGCGCY 1 cut(s) 62
HapII CCGG 1 cut(s) 218
HhaI GCGC 1 cut(s) 61
Hin1II CATG 1 cut(s) 277
Hin6I GCGC 1 cut(s) 59
HinP1I GCGC 1 cut(s) 59
HinfI GANTC 1 cut(s) 286
HpaII CCGG 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 163
Hpy188I TCNGA 2 cut(s) 144, 228
Hpy188III TCNNGA 3 cut(s) 76, 94, 218
Hpy8I GTNNAC 1 cut(s) 163
HpyCH4IV ACGT 1 cut(s) 165
HpyCH4V TGCA 1 cut(s) 238
HpyF3I CTNAG 1 cut(s) 246
HpySE526I ACGT 1 cut(s) 165
Hsp92II CATG 1 cut(s) 277
HspAI GCGC 1 cut(s) 59
Kpn2I TCCGGA 1 cut(s) 217
Kzo9I GATC 2 cut(s) 6, 322
LmnI GCTCC 1 cut(s) 317
LpnPI CCDG 3 cut(s) 231, 282, 329
Lsp1109I GCAGC 2 cut(s) 68, 222
MaeI CTAG 1 cut(s) 41
MaeII ACGT 1 cut(s) 165
MalI GATC 2 cut(s) 8, 324
MboI GATC 2 cut(s) 6, 322
MboII GAAGA 2 cut(s) 109, 308
MhlI GDGCHC 1 cut(s) 86
MluCI AATT 1 cut(s) 69
MnlI CCTC 5 cut(s) 57, 72, 234, 241, 244
MroI TCCGGA 1 cut(s) 217
MseI TTAA 2 cut(s) 264, 281
MspI CCGG 1 cut(s) 218
NdeII GATC 2 cut(s) 6, 322
NlaIII CATG 1 cut(s) 277
PaeR7I CTCGAG 1 cut(s) 85
PfeI GAWTC 1 cut(s) 286
PkrI GCNGC 2 cut(s) 58, 237
Ppu21I YACGTR 1 cut(s) 166
PspXI VCTCGAGB 1 cut(s) 85
PstI CTGCAG 1 cut(s) 240
RsaI GTAC 1 cut(s) 164
RsaNI GTAC 1 cut(s) 163
SaqAI TTAA 2 cut(s) 264, 281
SatI GCNGC 2 cut(s) 57, 236
Sau3AI GATC 2 cut(s) 6, 322
SduI GDGCHC 1 cut(s) 86
SetI ASST 3 cut(s) 83, 168, 233
SfcI CTRYAG 1 cut(s) 236
Sfr274I CTCGAG 1 cut(s) 85
SlaI CTCGAG 1 cut(s) 85
SmlI CTYRAG 2 cut(s) 74, 85
SmoI CTYRAG 2 cut(s) 74, 85
SnaBI TACGTA 1 cut(s) 166
Sse9I AATT 1 cut(s) 69
SspMI CTAG 1 cut(s) 41
TaiI ACGT 1 cut(s) 168
TaqI TCGA 1 cut(s) 86
TasI AATT 1 cut(s) 69
TfiI GAWTC 1 cut(s) 286
Tru1I TTAA 2 cut(s) 264, 281
Tru9I TTAA 2 cut(s) 264, 281
TseI GCWGC 2 cut(s) 56, 235
XapI RAATTY 1 cut(s) 69
XhoI CTCGAG 1 cut(s) 85
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.