Rmu_sc0005310.1_g000037

BRO1-like domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005310.1
Physical Location & Seq
Forward (+)
197256 .. 202383
5128 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005310.1_g000037.1.cds

Sequence Viewer

Length: 1278 bp
atgggatgcctggtgtcaacaccgaaagatacagttggaaataggaggaggccatcaaacatcggtgaagtttctgtttatgttcctggtctgcgaatacctaaacccgttgatttctctcagtcacttggtgatcatttgtccaagagtttagtagaacgtctatctgctttaagaactcgtatagttgtaatggctggccaagaaggtcctacaatcacaagaacaaggagaagaacccaacacggtggttcaacattagctgatctccagcaggctctcgaggattacttacctgttcttttgggattaatgaaagatggaagccagctacaacacaaggttcaatttgtgtgggtaaatcaagaggatgatgcagaggaaacagctatgtctaatggatggtacgaggtgatgtcaattttgcatttaatggcaatgctatcattatcacaagctaacttattacttcttccgagaacatctgctgacggtcaccagccaaaagtatcagaagagagtagacgagcttctgttgatatattcctgaaggctgcaggacaccttgactgtgctgtccgacatgttctcccacagttgcctgccgagctcaagagaaaccttccagttgatctagcagagggagttcttcgagctctttgcttacaagcactaggacagggtgttgatattcaacttggaatggcaattgatagtacaaaagccactcttgcagtgaagcgaaggcttgcatgtgagatggtaaagtattggcagcaggctcaagataacattatgaaccttccattattaaatggttggggtgaaaagcataaactctttgtaaagtggaaatatgttgaggcaaaggctgcagcatattattatcatggtttaatcctcgatgagggtaacacagaaaaatttcatggaatggctgtagctgctttgcaagcagcagacgagtattttaaagaaagtaagaaggcatgtgaggcatttaatgctgcttctcctttgtccagaaacccaccgctttggggaaccatgaaatatctatctgagaaaatcccaaaagatacttcaagcaaagtgcgaataaaccgtgatctgtactctcatgcaaaaatcatggagacagcaccgacattgcctgactttgctctggccttgaaacccgacgaatatcaacttcctccactggatccctcttggaacatggagcacacaaataggggaccaacagcttccaaccagctcaggaatgacaggaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

425

Amino Acids

47.41

Weight (kDa)

8.77

Isoelectric Point (pI)

47.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 575
AccI GTMKAC 1 cut(s) 523
AciI CCGC 1 cut(s) 1034
AclWI GGATC 2 cut(s) 1199, 1212
AcoI YGGCCR 1 cut(s) 199
AcsI RAATTY 1 cut(s) 923
AcuI CTGAAG 1 cut(s) 569
AdeI CACNNNGTG 1 cut(s) 131
AfaI GTAC 3 cut(s) 407, 718, 1115
AfiI CCNNNNNNNGG 2 cut(s) 907, 1040
AflIII ACRYGT 1 cut(s) 583
AgsI TTSAA 5 cut(s) 255, 347, 695, 1086, 1174
AjnI CCWGG 2 cut(s) 9, 85
AjuI GAANNNNNNNTTGG 2 cut(s) 1066, 1098
Alw21I GWGCWC 3 cut(s) 612, 658, 1227
Alw26I GTCTC 1 cut(s) 1130
AlwI GGATC 2 cut(s) 1199, 1212
Ama87I CYCGRG 1 cut(s) 281
AoxI GGCC 3 cut(s) 50, 199, 1167
ApeKI GCWGC 7 cut(s) 554, 775, 872, 875, 944, 956, 1007
ApoI RAATTY 1 cut(s) 923
AseI ATTAAT 1 cut(s) 311
Asp700I GAANNNNTTC 1 cut(s) 924
AspS9I GGNCC 2 cut(s) 209, 1238
AsuHPI GGTGA 5 cut(s) 77, 143, 424, 488, 836
AvaI CYCGRG 1 cut(s) 281
AvaII GGWCC 2 cut(s) 209, 1238
BalI TGGCCA 1 cut(s) 201
BamHI GGATCC 1 cut(s) 1204
BanII GRGCYC 2 cut(s) 612, 658
BarI GAAGNNNNNNTAC 2 cut(s) 514, 546
Bbv12I GWGCWC 3 cut(s) 612, 658, 1227
BbvI GCAGC 7 cut(s) 541, 787, 859, 887, 931, 968, 994
BccI CCATC 4 cut(s) 61, 314, 396, 754
BcgI CGANNNNNNTGC 2 cut(s) 642, 676
BciT130I CCWGG 2 cut(s) 11, 87
BclI TGATCA 1 cut(s) 133
BcoDI GTCTC 1 cut(s) 1130
BfaI CTAG 2 cut(s) 635, 674
BfmI CTRYAG 3 cut(s) 555, 873, 939
BisI GCNGC 7 cut(s) 555, 776, 873, 876, 945, 957, 1008
BlsI GCNGC 7 cut(s) 556, 777, 874, 877, 946, 958, 1009
Bme1390I CCNGG 2 cut(s) 11, 87
Bme18I GGWCC 2 cut(s) 209, 1238
BmeT110I CYCGRG 1 cut(s) 281
BmgT120I GGNCC 2 cut(s) 209, 1238
BmiI GGNNCC 3 cut(s) 1045, 1206, 1239
BmrFI CCNGG 2 cut(s) 11, 87
BmsI GCATC 1 cut(s) 364
BpmI CTGGAG 1 cut(s) 254
Bpu10I CCTNAGC 1 cut(s) 1259
BpuEI CTTGAG 2 cut(s) 596, 768
BsaXI ACNNNNNCTCC 2 cut(s) 573, 603
Bsc4I CCNNNNNNNGG 2 cut(s) 907, 1040
Bse1I ACTGG 2 cut(s) 626, 1206
Bse3DI GCAATG 2 cut(s) 444, 1148
BseBI CCWGG 2 cut(s) 11, 87
BseGI GGATG 3 cut(s) 11, 376, 407
BseLI CCNNNNNNNGG 2 cut(s) 907, 1040
BseMI GCAATG 2 cut(s) 444, 1148
BseMII CTCAG 3 cut(s) 134, 1053, 1273
BseNI ACTGG 2 cut(s) 626, 1206
BseRI GAGGAG 1 cut(s) 61
BseXI GCAGC 7 cut(s) 541, 787, 859, 887, 931, 968, 994
BshFI GGCC 3 cut(s) 52, 201, 1169
BsiHKAI GWGCWC 3 cut(s) 612, 658, 1227
BsiHKCI CYCGRG 1 cut(s) 281
BslFI GGGAC 1 cut(s) 1251
BslI CCNNNNNNNGG 2 cut(s) 907, 1040
BsmAI GTCTC 1 cut(s) 1130
BsmFI GGGAC 1 cut(s) 1251
BsnI GGCC 3 cut(s) 52, 201, 1169
BsoBI CYCGRG 1 cut(s) 281
Bsp1286I GDGCHC 3 cut(s) 612, 658, 1227
Bsp143I GATC 5 cut(s) 133, 265, 631, 1108, 1204
BspACI CCGC 1 cut(s) 1034
BspANI GGCC 3 cut(s) 52, 201, 1169
BspCNI CTCAG 3 cut(s) 133, 1054, 1272
BspLI GGNNCC 3 cut(s) 1045, 1206, 1239
BspMAI CTGCAG 2 cut(s) 559, 877
BspPI GGATC 2 cut(s) 1199, 1212
BsrDI GCAATG 2 cut(s) 444, 1148
BsrI ACTGG 2 cut(s) 626, 1206
BssMI GATC 5 cut(s) 133, 265, 631, 1108, 1204
Bst2UI CCWGG 2 cut(s) 11, 87
Bst4CI ACNGT 6 cut(s) 34, 248, 494, 572, 597, 1106
Bst6I CTCTTC 1 cut(s) 510
BstAPI GCANNNNNTGC 2 cut(s) 872, 1004
BstC8I GCNNGC 7 cut(s) 199, 276, 329, 603, 750, 780, 954
BstDEI CTNAG 3 cut(s) 120, 1062, 1259
BstEII GGTNACC 1 cut(s) 494
BstENI CCTNNNNNAGG 1 cut(s) 905
BstF5I GGATG 3 cut(s) 11, 376, 407
BstKTI GATC 5 cut(s) 136, 268, 634, 1111, 1207
BstMAI GTCTC 1 cut(s) 1130
BstMBI GATC 5 cut(s) 133, 265, 631, 1108, 1204
BstMWI GCNNNNNNNGC 7 cut(s) 607, 731, 872, 944, 953, 995, 1004
BstNI CCWGG 2 cut(s) 11, 87
BstNSI RCATGY 3 cut(s) 587, 756, 993
BstPI GGTNACC 1 cut(s) 494
BstSCI CCNGG 2 cut(s) 9, 85
BstSFI CTRYAG 3 cut(s) 555, 873, 939
BstV1I GCAGC 7 cut(s) 541, 787, 859, 887, 931, 968, 994
BstX2I RGATCY 1 cut(s) 1204
BstXI CCANNNNNNTGG 2 cut(s) 248, 1038
BstYI RGATCY 1 cut(s) 1204
BsuRI GGCC 3 cut(s) 52, 201, 1169
BtsCI GGATG 3 cut(s) 11, 376, 407
BtsI GCAGTG 1 cut(s) 741
BtsIMutI CAGTG 2 cut(s) 741, 1199
Cac8I GCNNGC 7 cut(s) 199, 276, 329, 603, 750, 780, 954
Cfr13I GGNCC 2 cut(s) 209, 1238
Csp6I GTAC 3 cut(s) 406, 717, 1114
CspCI CAANNNNNGTGG 2 cut(s) 335, 370
CviAII CATG 9 cut(s) 584, 753, 890, 929, 990, 1048, 1121, 1132, 1219
CviQI GTAC 3 cut(s) 406, 717, 1114
DdeI CTNAG 3 cut(s) 120, 1062, 1259
DpnI GATC 5 cut(s) 135, 267, 633, 1110, 1206
DpnII GATC 5 cut(s) 133, 265, 631, 1108, 1204
DraI TTTAAA 1 cut(s) 973
DraIII CACNNNGTG 1 cut(s) 131
DrdI GACNNNNNNGTC 1 cut(s) 575
DseDI GACNNNNNNGTC 1 cut(s) 575
EaeI YGGCCR 1 cut(s) 199
Eam1104I CTCTTC 1 cut(s) 510
EarI CTCTTC 1 cut(s) 510
Ecl136II GAGCTC 2 cut(s) 610, 656
Eco24I GRGCYC 2 cut(s) 612, 658
Eco47I GGWCC 2 cut(s) 209, 1238
Eco53kI GAGCTC 2 cut(s) 610, 656
Eco57I CTGAAG 1 cut(s) 569
Eco88I CYCGRG 1 cut(s) 281
Eco91I GGTNACC 1 cut(s) 494
EcoICRI GAGCTC 2 cut(s) 610, 656
EcoNI CCTNNNNNAGG 1 cut(s) 905
EcoO109I RGGNCCY 1 cut(s) 209
EcoO65I GGTNACC 1 cut(s) 494
EcoRII CCWGG 2 cut(s) 9, 85
EcoT38I GRGCYC 2 cut(s) 612, 658
FaeI CATG 9 cut(s) 587, 756, 893, 932, 993, 1051, 1124, 1135, 1222
FalI AAGNNNNNCTT 2 cut(s) 714, 746
FaqI GGGAC 1 cut(s) 1251
FatI CATG 9 cut(s) 583, 752, 889, 928, 989, 1047, 1120, 1131, 1218
FbaI TGATCA 1 cut(s) 133
FblI GTMKAC 1 cut(s) 523
Fnu4HI GCNGC 7 cut(s) 555, 776, 873, 876, 945, 957, 1008
FokI GGATG 3 cut(s) 18, 383, 414
FriOI GRGCYC 2 cut(s) 612, 658
Fsp4HI GCNGC 7 cut(s) 555, 776, 873, 876, 945, 957, 1008
FspBI CTAG 2 cut(s) 635, 674
GluI GCNGC 7 cut(s) 555, 776, 873, 876, 945, 957, 1008
GsuI CTGGAG 1 cut(s) 254
HaeIII GGCC 3 cut(s) 52, 201, 1169
Hin1II CATG 9 cut(s) 587, 756, 893, 932, 993, 1051, 1124, 1135, 1222
HincII GTYRAC 1 cut(s) 18
HindII GTYRAC 1 cut(s) 18
HphI GGTGA 5 cut(s) 77, 143, 424, 488, 836
Hpy166II GTNNAC 2 cut(s) 18, 524
Hpy188I TCNGA 4 cut(s) 477, 514, 581, 1063
Hpy188III TCNNGA 7 cut(s) 281, 365, 547, 613, 785, 1023, 1261
Hpy8I GTNNAC 2 cut(s) 18, 524
Hpy99I CGWCG 1 cut(s) 1184
HpyAV CCTTC 6 cut(s) 200, 544, 632, 738, 812, 979
HpyCH4III ACNGT 6 cut(s) 34, 248, 494, 572, 597, 1106
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 8 cut(s) 377, 427, 557, 734, 752, 875, 952, 1124
HpyF10VI GCNNNNNNNGC 7 cut(s) 607, 731, 872, 944, 953, 995, 1004
HpyF3I CTNAG 3 cut(s) 120, 1062, 1259
HpySE526I ACGT 1 cut(s) 160
Hsp92II CATG 9 cut(s) 587, 756, 893, 932, 993, 1051, 1124, 1135, 1222
Ksp22I TGATCA 1 cut(s) 133
Kzo9I GATC 5 cut(s) 133, 265, 631, 1108, 1204
LmnI GCTCC 1 cut(s) 1222
Lsp1109I GCAGC 7 cut(s) 541, 787, 859, 887, 931, 968, 994
LweI GCATC 1 cut(s) 364
MaeI CTAG 2 cut(s) 635, 674
MaeII ACGT 1 cut(s) 160
MaeIII GTNAC 3 cut(s) 123, 494, 911
MalI GATC 5 cut(s) 135, 267, 633, 1110, 1206
MboI GATC 5 cut(s) 133, 265, 631, 1108, 1204
MboII GAAGA 4 cut(s) 246, 464, 527, 641
MfeI CAATTG 1 cut(s) 708
MflI RGATCY 1 cut(s) 1204
MhlI GDGCHC 3 cut(s) 612, 658, 1227
MlsI TGGCCA 1 cut(s) 201
MluCI AATT 4 cut(s) 347, 420, 708, 923
MluNI TGGCCA 1 cut(s) 201
MmeI TCCRAC 3 cut(s) 16, 604, 1275
Mox20I TGGCCA 1 cut(s) 201
MroXI GAANNNNTTC 1 cut(s) 924
MscI TGGCCA 1 cut(s) 201
MseI TTAA 7 cut(s) 173, 311, 431, 812, 896, 972, 1002
Msp20I TGGCCA 1 cut(s) 201
MspR9I CCNGG 2 cut(s) 11, 87
MunI CAATTG 1 cut(s) 708
MvaI CCWGG 2 cut(s) 11, 87
MwoI GCNNNNNNNGC 7 cut(s) 607, 731, 872, 944, 953, 995, 1004
NdeII GATC 5 cut(s) 133, 265, 631, 1108, 1204
NlaIII CATG 9 cut(s) 587, 756, 893, 932, 993, 1051, 1124, 1135, 1222
NlaIV GGNNCC 3 cut(s) 1045, 1206, 1239
NmeAIII GCCGAG 1 cut(s) 631
NmuCI GTSAC 2 cut(s) 123, 494
NspI RCATGY 3 cut(s) 587, 756, 993
PaeR7I CTCGAG 1 cut(s) 281
PciI ACATGT 1 cut(s) 583
PdmI GAANNNNTTC 1 cut(s) 924
PkrI GCNGC 7 cut(s) 556, 777, 874, 877, 946, 958, 1009
PpuMI RGGWCCY 1 cut(s) 209
PscI ACATGT 1 cut(s) 583
PshBI ATTAAT 1 cut(s) 311
Psp124BI GAGCTC 2 cut(s) 612, 658
Psp5II RGGWCCY 1 cut(s) 209
Psp6I CCWGG 2 cut(s) 9, 85
PspEI GGTNACC 1 cut(s) 494
PspGI CCWGG 2 cut(s) 9, 85
PspN4I GGNNCC 3 cut(s) 1045, 1206, 1239
PspPI GGNCC 2 cut(s) 209, 1238
PspPPI RGGWCCY 1 cut(s) 209
PstI CTGCAG 2 cut(s) 559, 877
PsuI RGATCY 1 cut(s) 1204
RsaI GTAC 3 cut(s) 407, 718, 1115
RsaNI GTAC 3 cut(s) 406, 717, 1114
SacI GAGCTC 2 cut(s) 612, 658
SaqAI TTAA 7 cut(s) 173, 311, 431, 812, 896, 972, 1002
SatI GCNGC 7 cut(s) 555, 776, 873, 876, 945, 957, 1008
Sau3AI GATC 5 cut(s) 133, 265, 631, 1108, 1204
Sau96I GGNCC 2 cut(s) 209, 1238
ScrFI CCNGG 2 cut(s) 11, 87
SduI GDGCHC 3 cut(s) 612, 658, 1227
SfaNI GCATC 1 cut(s) 364
SfcI CTRYAG 3 cut(s) 555, 873, 939
Sfr274I CTCGAG 1 cut(s) 281
SinI GGWCC 2 cut(s) 209, 1238
SlaI CTCGAG 1 cut(s) 281
SmlI CTYRAG 3 cut(s) 281, 611, 783
SmoI CTYRAG 3 cut(s) 281, 611, 783
Sse9I AATT 4 cut(s) 347, 420, 708, 923
SsiI CCGC 1 cut(s) 1034
SspMI CTAG 2 cut(s) 635, 674
SstI GAGCTC 2 cut(s) 612, 658
StyD4I CCNGG 2 cut(s) 9, 85
TaaI ACNGT 6 cut(s) 34, 248, 494, 572, 597, 1106
TaiI ACGT 1 cut(s) 163
TaqI TCGA 3 cut(s) 282, 652, 903
TasI AATT 4 cut(s) 347, 420, 708, 923
TatI WGTACW 2 cut(s) 716, 1113
Tru1I TTAA 7 cut(s) 173, 311, 431, 812, 896, 972, 1002
Tru9I TTAA 7 cut(s) 173, 311, 431, 812, 896, 972, 1002
TscAI CASTG 2 cut(s) 741, 1206
TseFI GTSAC 2 cut(s) 123, 494
TseI GCWGC 7 cut(s) 554, 775, 872, 875, 944, 956, 1007
Tsp45I GTSAC 2 cut(s) 123, 494
TspDTI ATGAA 4 cut(s) 329, 812, 917, 1064
TspRI CASTG 2 cut(s) 741, 1206
VpaK11BI GGWCC 2 cut(s) 209, 1238
VspI ATTAAT 1 cut(s) 311
XagI CCTNNNNNAGG 1 cut(s) 905
XapI RAATTY 1 cut(s) 923
XceI RCATGY 3 cut(s) 587, 756, 993
XhoI CTCGAG 1 cut(s) 281
XmiI GTMKAC 1 cut(s) 523
XmnI GAANNNNTTC 1 cut(s) 924
XspI CTAG 2 cut(s) 635, 674
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.