Rmu_sc0005410.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005410.1
Physical Location & Seq
Reverse (-)
1477 .. 1968
492 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005410.1_g000002.1.cds

Sequence Viewer

Length: 492 bp
atggaattttctgtgtgtcacaagaatgcacaatacttgtgctattctaaccccatatgcaaaaccaaacgcccttcaactctaccatgccaaatcagccctcgtcggaatgtatcgaggaccagttcgggattgagaactccggcatcgagcttaatacagcaacgagtgcatgaccataggagatcagctgtggtagtaggatgcgcaaacaagggttgttcaacagggatggcaggcgaaatagaaagagaactggaggctgagatgcgaccggaagaaggagctgagtggttgggagtaggcaggctgagagacaagtgtggaggaggcagaggaggagccgtggagctgttggagtgtttggaaagggaagcaatcatgggcgaagatgagggcaaagaaccagacgactacaacaggagagctcaaatcttctacaaaagtgcaagagttttccaggctcttagagagagtgctaataatgaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

163

Amino Acids

18.15

Weight (kDa)

8.13

Isoelectric Point (pI)

58.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013545)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 208
AcsI RAATTY 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 281
AgsI TTSAA 2 cut(s) 78, 225
AjnI CCWGG 1 cut(s) 459
AluBI AGCT 5 cut(s) 153, 191, 287, 352, 428
AluI AGCT 5 cut(s) 153, 191, 287, 352, 428
Alw21I GWGCWC 1 cut(s) 430
Alw26I GTCTC 1 cut(s) 309
ApoI RAATTY 1 cut(s) 5
AspLEI GCGC 1 cut(s) 209
AspS9I GGNCC 1 cut(s) 120
AvaII GGWCC 1 cut(s) 120
BanII GRGCYC 1 cut(s) 430
Bbv12I GWGCWC 1 cut(s) 430
BccI CCATC 1 cut(s) 226
BceAI ACGGC 1 cut(s) 329
BciT130I CCWGG 1 cut(s) 461
BcoDI GTCTC 1 cut(s) 309
Bme1390I CCNGG 1 cut(s) 461
Bme18I GGWCC 1 cut(s) 120
BmgT120I GGNCC 1 cut(s) 120
BmiI GGNNCC 1 cut(s) 343
BmrFI CCNGG 1 cut(s) 461
BmsI GCATC 3 cut(s) 155, 194, 258
BpmI CTGGAG 1 cut(s) 278
BsaJI CCNNGG 1 cut(s) 345
BsaWI WCCGGW 1 cut(s) 274
BsaXI ACNNNNNCTCC 2 cut(s) 330, 360
Bsc4I CCNNNNNNNGG 1 cut(s) 281
Bse1I ACTGG 2 cut(s) 123, 261
BseBI CCWGG 1 cut(s) 461
BseDI CCNNGG 1 cut(s) 345
BseGI GGATG 2 cut(s) 209, 237
BseLI CCNNNNNNNGG 1 cut(s) 281
BseMII CTCAG 3 cut(s) 255, 279, 302
BseNI ACTGG 2 cut(s) 123, 261
BseRI GAGGAG 3 cut(s) 342, 351, 354
Bsh1285I CGRYCG 1 cut(s) 275
BsiEI CGRYCG 1 cut(s) 275
BsiHKAI GWGCWC 1 cut(s) 430
BsiSI CCGG 2 cut(s) 143, 275
BslI CCNNNNNNNGG 1 cut(s) 281
BsmAI GTCTC 1 cut(s) 309
BsmI GAATGC 1 cut(s) 31
Bsp1286I GDGCHC 1 cut(s) 430
Bsp143I GATC 1 cut(s) 185
BspCNI CTCAG 3 cut(s) 256, 280, 303
BspLI GGNNCC 1 cut(s) 343
BsrI ACTGG 2 cut(s) 123, 261
BssECI CCNNGG 1 cut(s) 345
BssMI GATC 1 cut(s) 185
Bst2UI CCWGG 1 cut(s) 461
BstAPI GCANNNNNTGC 1 cut(s) 169
BstC8I GCNNGC 2 cut(s) 238, 308
BstDEI CTNAG 4 cut(s) 264, 288, 311, 467
BstDSI CCRYGG 1 cut(s) 345
BstF5I GGATG 2 cut(s) 209, 237
BstHHI GCGC 1 cut(s) 209
BstKTI GATC 1 cut(s) 188
BstMAI GTCTC 1 cut(s) 309
BstMBI GATC 1 cut(s) 185
BstMCI CGRYCG 1 cut(s) 275
BstMWI GCNNNNNNNGC 2 cut(s) 96, 169
BstNI CCWGG 1 cut(s) 461
BstSCI CCNGG 1 cut(s) 459
BtgI CCRYGG 1 cut(s) 345
BtsCI GGATG 2 cut(s) 209, 237
Cac8I GCNNGC 2 cut(s) 238, 308
CfoI GCGC 1 cut(s) 209
Cfr13I GGNCC 1 cut(s) 120
CviAII CATG 3 cut(s) 87, 173, 382
DdeI CTNAG 4 cut(s) 264, 288, 311, 467
DpnI GATC 1 cut(s) 187
DpnII GATC 1 cut(s) 185
Ecl136II GAGCTC 1 cut(s) 428
Eco24I GRGCYC 1 cut(s) 430
Eco47I GGWCC 1 cut(s) 120
Eco53kI GAGCTC 1 cut(s) 428
EcoICRI GAGCTC 1 cut(s) 428
EcoRII CCWGG 1 cut(s) 459
EcoT38I GRGCYC 1 cut(s) 430
FaeI CATG 3 cut(s) 90, 176, 385
FaiI YATR 6 cut(s) 56, 58, 88, 174, 180, 383
FatI CATG 3 cut(s) 86, 172, 381
FauNDI CATATG 1 cut(s) 56
FokI GGATG 2 cut(s) 216, 244
FriOI GRGCYC 1 cut(s) 430
FspI TGCGCA 1 cut(s) 208
GlaI GCGC 1 cut(s) 208
GsuI CTGGAG 1 cut(s) 278
HapII CCGG 2 cut(s) 143, 275
HhaI GCGC 1 cut(s) 209
Hin1II CATG 3 cut(s) 90, 176, 385
Hin6I GCGC 1 cut(s) 207
HinP1I GCGC 1 cut(s) 207
HpaII CCGG 2 cut(s) 143, 275
Hpy188I TCNGA 1 cut(s) 108
Hpy188III TCNNGA 1 cut(s) 129
Hpy99I CGWCG 1 cut(s) 108
HpyAV CCTTC 2 cut(s) 84, 275
HpyCH4V TGCA 4 cut(s) 29, 60, 172, 449
HpyF10VI GCNNNNNNNGC 2 cut(s) 96, 169
HpyF3I CTNAG 4 cut(s) 264, 288, 311, 467
Hsp92II CATG 3 cut(s) 90, 176, 385
HspAI GCGC 1 cut(s) 207
Kzo9I GATC 1 cut(s) 185
LmnI GCTCC 3 cut(s) 284, 341, 349
LweI GCATC 3 cut(s) 155, 194, 258
MaeIII GTNAC 1 cut(s) 17
MalI GATC 1 cut(s) 187
MboI GATC 1 cut(s) 185
MboII GAAGA 3 cut(s) 290, 401, 427
MhlI GDGCHC 1 cut(s) 430
MluCI AATT 1 cut(s) 5
MmeI TCCRAC 2 cut(s) 86, 336
MnlI CCTC 8 cut(s) 111, 111, 253, 320, 323, 329, 332, 388
MseI TTAA 1 cut(s) 155
MslI CAYNNNNRTG 1 cut(s) 24
MspA1I CMGCKG 1 cut(s) 191
MspI CCGG 2 cut(s) 143, 275
MspR9I CCNGG 1 cut(s) 461
Mva1269I GAATGC 1 cut(s) 31
MvaI CCWGG 1 cut(s) 461
MwoI GCNNNNNNNGC 2 cut(s) 96, 169
NdeI CATATG 1 cut(s) 56
NdeII GATC 1 cut(s) 185
NlaIII CATG 3 cut(s) 90, 176, 385
NlaIV GGNNCC 1 cut(s) 343
NmuCI GTSAC 1 cut(s) 17
NsbI TGCGCA 1 cut(s) 208
PctI GAATGC 1 cut(s) 31
Psp124BI GAGCTC 1 cut(s) 430
Psp6I CCWGG 1 cut(s) 459
PspGI CCWGG 1 cut(s) 459
PspN4I GGNNCC 1 cut(s) 343
PspPI GGNCC 1 cut(s) 120
PvuII CAGCTG 1 cut(s) 191
RseI CAYNNNNRTG 1 cut(s) 24
SacI GAGCTC 1 cut(s) 430
SaqAI TTAA 1 cut(s) 155
Sau3AI GATC 1 cut(s) 185
Sau96I GGNCC 1 cut(s) 120
ScrFI CCNGG 1 cut(s) 461
SduI GDGCHC 1 cut(s) 430
SetI ASST 5 cut(s) 155, 193, 289, 354, 430
SfaNI GCATC 3 cut(s) 155, 194, 258
SinI GGWCC 1 cut(s) 120
SmiMI CAYNNNNRTG 1 cut(s) 24
Sse9I AATT 1 cut(s) 5
SstI GAGCTC 1 cut(s) 430
StyD4I CCNGG 1 cut(s) 459
TaqI TCGA 2 cut(s) 116, 149
TasI AATT 1 cut(s) 5
Tru1I TTAA 1 cut(s) 155
Tru9I TTAA 1 cut(s) 155
TseFI GTSAC 1 cut(s) 17
Tsp45I GTSAC 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 120
XapI RAATTY 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.