Rmu_sc0005718.1_g000002

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005718.1
Physical Location & Seq
Reverse (-)
7773 .. 9112
1340 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005718.1_g000002.1.cds

Sequence Viewer

Length: 579 bp
atgggaggttgctgctgttcttccagaaaagctcatctccatggagcacctgtgtatttctattgttcaccagctttggaagaggaagagtcgttaacatcccatgatgttgcagcctctgcaataaccgcaggaatcctagttaatttggatctggaaacatcaataccagacacttacagatcccctcctacacccctgccatatgatatggtcttcggatgtccacaatcaacagattctgattctgtcagagaaacaaatagttgcagtagttttgaaacttcacctacatgtggagatcttgaggaatcagaatgcaaagttcaagaaagttctttgccgatctcaccaaagaagttagaactttcaaaatccaataaagtaaatgttttagcagaagaagatgaggatgtttgtccaatttgtcttgaagagtatgaaacagagaatccagatttcatcacaaaatgcgaacaccactatcacctctcctgcattcttgagtggatagaaagaagtgatgcctgtcctatatgtgatcaggaactggtattggaccattcctatagtttgtag

Protein Analysis

192

Amino Acids

21.22

Weight (kDa)

4.31

Isoelectric Point (pI)

74.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 129
AclWI GGATC 2 cut(s) 159, 177
AfiI CCNNNNNNNGG 1 cut(s) 296
AflIII ACRYGT 1 cut(s) 293
AgsI TTSAA 4 cut(s) 281, 329, 372, 434
AluBI AGCT 2 cut(s) 32, 74
AluI AGCT 2 cut(s) 32, 74
Alw21I GWGCWC 1 cut(s) 49
AlwI GGATC 2 cut(s) 159, 177
AlwNI CAGNNNCTG 3 cut(s) 119, 242, 550
ApeKI GCWGC 2 cut(s) 12, 113
AspS9I GGNCC 1 cut(s) 559
AsuHPI GGTGA 4 cut(s) 60, 279, 342, 479
AvaII GGWCC 1 cut(s) 559
BbsI GAAGAC 1 cut(s) 208
Bbv12I GWGCWC 1 cut(s) 49
BbvI GCAGC 1 cut(s) 125
BclI TGATCA 1 cut(s) 541
BfaI CTAG 1 cut(s) 140
BfmI CTRYAG 1 cut(s) 568
BglII AGATCT 1 cut(s) 301
BisI GCNGC 2 cut(s) 13, 114
BlsI GCNGC 2 cut(s) 14, 115
Bme18I GGWCC 1 cut(s) 559
BmgT120I GGNCC 1 cut(s) 559
BmsI GCATC 1 cut(s) 514
BpiI GAAGAC 1 cut(s) 208
BpuEI CTTGAG 2 cut(s) 326, 524
BsaJI CCNNGG 1 cut(s) 40
BsaXI ACNNNNNCTCC 2 cut(s) 36, 66
Bsc4I CCNNNNNNNGG 1 cut(s) 296
Bse1I ACTGG 1 cut(s) 555
BseDI CCNNGG 1 cut(s) 40
BseGI GGATG 3 cut(s) 98, 227, 418
BseLI CCNNNNNNNGG 1 cut(s) 296
BseNI ACTGG 1 cut(s) 555
BseXI GCAGC 1 cut(s) 125
BsiHKAI GWGCWC 1 cut(s) 49
BslI CCNNNNNNNGG 1 cut(s) 296
BsmI GAATGC 2 cut(s) 323, 498
Bsp1286I GDGCHC 1 cut(s) 49
Bsp143I GATC 5 cut(s) 151, 182, 301, 345, 541
Bsp19I CCATGG 1 cut(s) 40
BspACI CCGC 1 cut(s) 129
BspPI GGATC 2 cut(s) 159, 177
BsrI ACTGG 1 cut(s) 555
BssECI CCNNGG 1 cut(s) 40
BssMI GATC 5 cut(s) 151, 182, 301, 345, 541
BssT1I CCWWGG 1 cut(s) 40
Bst6I CTCTTC 3 cut(s) 75, 81, 429
BstAPI GCANNNNNTGC 1 cut(s) 119
BstDSI CCRYGG 1 cut(s) 40
BstF5I GGATG 3 cut(s) 98, 227, 418
BstKTI GATC 5 cut(s) 154, 185, 304, 348, 544
BstMBI GATC 5 cut(s) 151, 182, 301, 345, 541
BstMWI GCNNNNNNNGC 2 cut(s) 119, 128
BstNSI RCATGY 1 cut(s) 297
BstSFI CTRYAG 1 cut(s) 568
BstV1I GCAGC 1 cut(s) 125
BstV2I GAAGAC 1 cut(s) 208
BstX2I RGATCY 3 cut(s) 151, 182, 301
BstYI RGATCY 3 cut(s) 151, 182, 301
BtgI CCRYGG 1 cut(s) 40
BtsCI GGATG 3 cut(s) 98, 227, 418
CaiI CAGNNNCTG 3 cut(s) 119, 242, 550
Cfr13I GGNCC 1 cut(s) 559
CviAII CATG 3 cut(s) 41, 104, 294
CviJI RGCY 3 cut(s) 32, 74, 116
CviKI_1 RGCY 3 cut(s) 32, 74, 116
DpnI GATC 5 cut(s) 153, 184, 303, 347, 543
DpnII GATC 5 cut(s) 151, 182, 301, 345, 541
Eam1104I CTCTTC 3 cut(s) 75, 81, 429
EarI CTCTTC 3 cut(s) 75, 81, 429
Eco130I CCWWGG 1 cut(s) 40
Eco47I GGWCC 1 cut(s) 559
EcoT14I CCWWGG 1 cut(s) 40
ErhI CCWWGG 1 cut(s) 40
FaeI CATG 3 cut(s) 44, 107, 297
FatI CATG 3 cut(s) 40, 103, 293
FauNDI CATATG 1 cut(s) 205
FbaI TGATCA 1 cut(s) 541
Fnu4HI GCNGC 2 cut(s) 13, 114
FokI GGATG 3 cut(s) 85, 234, 425
Fsp4HI GCNGC 2 cut(s) 13, 114
FspBI CTAG 1 cut(s) 140
GluI GCNGC 2 cut(s) 13, 114
Hin1II CATG 3 cut(s) 44, 107, 297
HincII GTYRAC 1 cut(s) 96
HindII GTYRAC 1 cut(s) 96
HinfI GANTC 6 cut(s) 89, 135, 239, 245, 311, 451
HpaI GTTAAC 1 cut(s) 96
HphI GGTGA 4 cut(s) 60, 279, 342, 479
Hpy166II GTNNAC 3 cut(s) 68, 96, 227
Hpy188I TCNGA 4 cut(s) 221, 244, 254, 316
Hpy188III TCNNGA 8 cut(s) 24, 155, 305, 329, 431, 455, 503, 545
Hpy8I GTNNAC 3 cut(s) 68, 96, 227
HpyCH4V TGCA 5 cut(s) 113, 122, 270, 321, 498
HpyF10VI GCNNNNNNNGC 2 cut(s) 119, 128
Hsp92II CATG 3 cut(s) 44, 107, 297
Ksp22I TGATCA 1 cut(s) 541
KspAI GTTAAC 1 cut(s) 96
Kzo9I GATC 5 cut(s) 151, 182, 301, 345, 541
LmnI GCTCC 1 cut(s) 44
Lsp1109I GCAGC 1 cut(s) 125
LweI GCATC 1 cut(s) 514
MaeI CTAG 1 cut(s) 140
MalI GATC 5 cut(s) 153, 184, 303, 347, 543
MboI GATC 5 cut(s) 151, 182, 301, 345, 541
MboII GAAGA 7 cut(s) 12, 92, 98, 208, 413, 416, 446
MflI RGATCY 3 cut(s) 151, 182, 301
MhlI GDGCHC 1 cut(s) 49
MluCI AATT 2 cut(s) 145, 423
MlyI GAGTC 1 cut(s) 98
MnlI CCTC 6 cut(s) 76, 127, 198, 301, 403, 500
MseI TTAA 2 cut(s) 95, 144
MslI CAYNNNNRTG 2 cut(s) 39, 292
Mva1269I GAATGC 2 cut(s) 323, 498
MwoI GCNNNNNNNGC 2 cut(s) 119, 128
NcoI CCATGG 1 cut(s) 40
NdeI CATATG 1 cut(s) 205
NdeII GATC 5 cut(s) 151, 182, 301, 345, 541
NlaIII CATG 3 cut(s) 44, 107, 297
NspI RCATGY 1 cut(s) 297
PciI ACATGT 1 cut(s) 293
PctI GAATGC 2 cut(s) 323, 498
PfeI GAWTC 5 cut(s) 135, 239, 245, 311, 451
PkrI GCNGC 2 cut(s) 14, 115
PleI GAGTC 1 cut(s) 97
PpsI GAGTC 1 cut(s) 97
PscI ACATGT 1 cut(s) 293
PspPI GGNCC 1 cut(s) 559
PstNI CAGNNNCTG 3 cut(s) 119, 242, 550
PsuI RGATCY 3 cut(s) 151, 182, 301
RseI CAYNNNNRTG 2 cut(s) 39, 292
SaqAI TTAA 2 cut(s) 95, 144
SatI GCNGC 2 cut(s) 13, 114
Sau3AI GATC 5 cut(s) 151, 182, 301, 345, 541
Sau96I GGNCC 1 cut(s) 559
SchI GAGTC 1 cut(s) 98
SduI GDGCHC 1 cut(s) 49
SetI ASST 6 cut(s) 10, 34, 52, 76, 292, 492
SfaNI GCATC 1 cut(s) 514
SfcI CTRYAG 1 cut(s) 568
SinI GGWCC 1 cut(s) 559
SmiMI CAYNNNNRTG 2 cut(s) 39, 292
SmlI CTYRAG 2 cut(s) 305, 503
SmoI CTYRAG 2 cut(s) 305, 503
Sse9I AATT 2 cut(s) 145, 423
SsiI CCGC 1 cut(s) 129
SspMI CTAG 1 cut(s) 140
StyI CCWWGG 1 cut(s) 40
TasI AATT 2 cut(s) 145, 423
TfiI GAWTC 5 cut(s) 135, 239, 245, 311, 451
Tru1I TTAA 2 cut(s) 95, 144
Tru9I TTAA 2 cut(s) 95, 144
TseI GCWGC 2 cut(s) 12, 113
TspDTI ATGAA 2 cut(s) 451, 456
VpaK11BI GGWCC 1 cut(s) 559
XceI RCATGY 1 cut(s) 297
XspI CTAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.