Rh1AG264900

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
49150657 .. 49151571
915 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG264900.1

Sequence Viewer

Length: 369 bp
ATGGTCTTCGGATGTCCACAATCAACAGATTCTGATTCTGTCAGAGAAACAAATAGTTGCAGTAGTTTTGAAACTTCACCTACATGTGGAGATCTTGAGGAATCAGACTGCAAAGTTCAAGAAAGTTCTTTGCCGATCTCACCAAAGAAGTTAGAACTTTCAAAATCCAATAAAGTAAATATTTTAGCAGAAGAAGATGAGGATGTTTGTCCAATTTGTCTTGAAGAGTATGAAACAGAGAATCCAGATTTCACCACAAAATGCGAACACCACTATCACCTCTCCTGCATTCTTGAGTGGATAGAAAGAAGTGATGCCTGTCCTATATGTGATCAGGAACTGGTATTGGACCATTCCTATAGTTTGTAG

Protein Analysis

122

Amino Acids

13.76

Weight (kDa)

4.21

Isoelectric Point (pI)

79.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-rbx1 PF12678 66 - 110 1.1e-10 RING-H2 zinc finger domain
zf-RING_2 PF13639 69 - 110 6.3e-12 Ring finger domain
zf-C3HC4_2 PF13923 70 - 110 2e-09 Zinc finger, C3HC4 type (RING finger)
zf-C3HC4 PF00097 70 - 110 8.1e-09 Zinc finger, C3HC4 type (RING finger)
zf-RING_UBOX PF13445 70 - 100 6.1e-07 RING-type zinc-finger
zf-RING_11 PF17123 70 - 97 2.7e-06 RING-like zinc finger
zf-RING_5 PF14634 70 - 112 7.2e-06 zinc-RING finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 86
AflIII ACRYGT 1 cut(s) 83
AgsI TTSAA 4 cut(s) 71, 119, 162, 224
AlwNI CAGNNNCTG 2 cut(s) 32, 340
AspS9I GGNCC 1 cut(s) 349
AsuHPI GGTGA 4 cut(s) 69, 132, 244, 269
AvaII GGWCC 1 cut(s) 349
BclI TGATCA 1 cut(s) 331
BfmI CTRYAG 1 cut(s) 358
BglII AGATCT 1 cut(s) 91
Bme18I GGWCC 1 cut(s) 349
BmgT120I GGNCC 1 cut(s) 349
BmsI GCATC 1 cut(s) 304
BpuEI CTTGAG 2 cut(s) 116, 314
Bsc4I CCNNNNNNNGG 1 cut(s) 86
Bse1I ACTGG 1 cut(s) 345
BseGI GGATG 2 cut(s) 17, 208
BseLI CCNNNNNNNGG 1 cut(s) 86
BseNI ACTGG 1 cut(s) 345
BslI CCNNNNNNNGG 1 cut(s) 86
BsmI GAATGC 1 cut(s) 288
Bsp143I GATC 3 cut(s) 91, 135, 331
BsrI ACTGG 1 cut(s) 345
BssMI GATC 3 cut(s) 91, 135, 331
Bst6I CTCTTC 1 cut(s) 219
BstF5I GGATG 2 cut(s) 17, 208
BstKTI GATC 3 cut(s) 94, 138, 334
BstMBI GATC 3 cut(s) 91, 135, 331
BstNSI RCATGY 1 cut(s) 87
BstSFI CTRYAG 1 cut(s) 358
BstX2I RGATCY 1 cut(s) 91
BstYI RGATCY 1 cut(s) 91
BtsCI GGATG 2 cut(s) 17, 208
CaiI CAGNNNCTG 2 cut(s) 32, 340
Cfr13I GGNCC 1 cut(s) 349
CviAII CATG 1 cut(s) 84
DpnI GATC 3 cut(s) 93, 137, 333
DpnII GATC 3 cut(s) 91, 135, 331
Eam1104I CTCTTC 1 cut(s) 219
EarI CTCTTC 1 cut(s) 219
Eco47I GGWCC 1 cut(s) 349
FaeI CATG 1 cut(s) 87
FaiI YATR 5 cut(s) 85, 231, 326, 328, 360
FatI CATG 1 cut(s) 83
FbaI TGATCA 1 cut(s) 331
FokI GGATG 2 cut(s) 24, 215
Hin1II CATG 1 cut(s) 87
HinfI GANTC 4 cut(s) 29, 35, 101, 241
HphI GGTGA 4 cut(s) 69, 132, 244, 269
Hpy166II GTNNAC 1 cut(s) 17
Hpy188I TCNGA 4 cut(s) 11, 34, 44, 106
Hpy188III TCNNGA 6 cut(s) 95, 119, 221, 245, 293, 335
Hpy8I GTNNAC 1 cut(s) 17
HpyCH4V TGCA 3 cut(s) 60, 111, 288
Hsp92II CATG 1 cut(s) 87
Ksp22I TGATCA 1 cut(s) 331
Kzo9I GATC 3 cut(s) 91, 135, 331
LpnPI CCDG 5 cut(s) 258, 298, 320, 326, 331
LweI GCATC 1 cut(s) 304
MalI GATC 3 cut(s) 93, 137, 333
MboI GATC 3 cut(s) 91, 135, 331
MboII GAAGA 3 cut(s) 203, 206, 236
MflI RGATCY 1 cut(s) 91
MluCI AATT 1 cut(s) 213
MnlI CCTC 3 cut(s) 91, 193, 290
MslI CAYNNNNRTG 1 cut(s) 82
Mva1269I GAATGC 1 cut(s) 288
NdeII GATC 3 cut(s) 91, 135, 331
NlaIII CATG 1 cut(s) 87
NspI RCATGY 1 cut(s) 87
PciI ACATGT 1 cut(s) 83
PctI GAATGC 1 cut(s) 288
PfeI GAWTC 4 cut(s) 29, 35, 101, 241
PscI ACATGT 1 cut(s) 83
PspPI GGNCC 1 cut(s) 349
PstNI CAGNNNCTG 2 cut(s) 32, 340
PsuI RGATCY 1 cut(s) 91
RseI CAYNNNNRTG 1 cut(s) 82
Sau3AI GATC 3 cut(s) 91, 135, 331
Sau96I GGNCC 1 cut(s) 349
SetI ASST 2 cut(s) 82, 282
SfaNI GCATC 1 cut(s) 304
SfcI CTRYAG 1 cut(s) 358
SinI GGWCC 1 cut(s) 349
SmiMI CAYNNNNRTG 1 cut(s) 82
SmlI CTYRAG 2 cut(s) 95, 293
SmoI CTYRAG 2 cut(s) 95, 293
Sse9I AATT 1 cut(s) 213
SspI AATATT 1 cut(s) 181
TasI AATT 1 cut(s) 213
TfiI GAWTC 4 cut(s) 29, 35, 101, 241
TspDTI ATGAA 1 cut(s) 246
VpaK11BI GGWCC 1 cut(s) 349
XceI RCATGY 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.