Rmu_sc0006267.1_g000001

PP2A regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006267.1
Physical Location & Seq
Forward (+)
80 .. 1543
1464 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006267.1_g000001.1.cds

Sequence Viewer

Length: 756 bp
atgaaggagaggaaagagcggagagggcgttcaactagagcttctgccttgtcaactcctattgaagcaggagatgaagatgtgctggatgatgatggagaagaggaacgagaggcctggtttacttctatctctttggcactctgtaaggcttttgatctattggaaatgctaaagaaggaagaagagatgctgctagcttttaaggaaaggcaatcaaaggagggggataaggaattttatcaagaagttcttgatgatcgtgctcagagggctgaagcttggcatcgtaatgctgcagctcaagtgcagtatagtaaaccagcacagcccatcacatgtgcaacttttgcacaagatgttttagaagggagagcaagtgtgtcacagatgcatgagcacaaacaccagcctctaatctttggaccagcaagtcttgttggtggaagcataacaagtgagagggaaaggatggcagctcaggttttccagcctagtcataggttacccaccatgagcattgaggaagctgggctgaaggagatggagataatgaacaaatggcaagagaggaatgttaaactcatggaagaagcaaactcttcatggtacaatgacagtgggaaactgccaggaccgccccaggaagatgatgaagatgatgatgctgctcaagacaaggcaagggcatgggatgactggaaagacgataatcctcgaggtgctggcaataagaagctcaccccttgtggataa

Protein Analysis

251

Amino Acids

28.47

Weight (kDa)

4.86

Isoelectric Point (pI)

49.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 432
AbsI CCTCGAGG 1 cut(s) 717
AccBSI CCGCTC 1 cut(s) 19
AciI CCGC 2 cut(s) 19, 638
AcsI RAATTY 1 cut(s) 236
AcuI CTGAAG 2 cut(s) 297, 557
AfaI GTAC 1 cut(s) 611
AflIII ACRYGT 1 cut(s) 338
AgsI TTSAA 2 cut(s) 33, 65
AjnI CCWGG 3 cut(s) 116, 631, 642
AloI GAACNNNNNNTCC 2 cut(s) 13, 45
AluBI AGCT 7 cut(s) 41, 200, 281, 302, 479, 530, 739
AluI AGCT 7 cut(s) 41, 200, 281, 302, 479, 530, 739
Alw21I GWGCWC 2 cut(s) 268, 402
Ama87I CYCGRG 1 cut(s) 717
AoxI GGCC 1 cut(s) 114
ApeKI GCWGC 5 cut(s) 193, 296, 299, 476, 668
ApoI RAATTY 1 cut(s) 236
AspS9I GGNCC 2 cut(s) 425, 635
AsuHPI GGTGA 1 cut(s) 733
AsuNHI GCTAGC 1 cut(s) 196
AvaI CYCGRG 1 cut(s) 717
AvaII GGWCC 2 cut(s) 425, 635
Bbv12I GWGCWC 2 cut(s) 268, 402
BbvI GCAGC 5 cut(s) 180, 283, 311, 488, 655
BccI CCATC 4 cut(s) 89, 341, 466, 538
BciT130I CCWGG 3 cut(s) 118, 633, 644
BfaI CTAG 3 cut(s) 36, 197, 495
BfmI CTRYAG 1 cut(s) 297
BisI GCNGC 5 cut(s) 194, 297, 300, 477, 669
BlsI GCNGC 5 cut(s) 195, 298, 301, 478, 670
Bme1390I CCNGG 3 cut(s) 118, 633, 644
Bme18I GGWCC 2 cut(s) 425, 635
BmeT110I CYCGRG 1 cut(s) 717
BmgT120I GGNCC 2 cut(s) 425, 635
BmrFI CCNGG 3 cut(s) 118, 633, 644
BmsI GCATC 4 cut(s) 180, 295, 381, 655
BmtI GCTAGC 1 cut(s) 200
Bpu10I CCTNAGC 1 cut(s) 480
BpuEI CTTGAG 2 cut(s) 288, 657
BsaJI CCNNGG 1 cut(s) 642
BsaXI ACNNNNNCTCC 4 cut(s) 13, 43, 364, 394
Bse1I ACTGG 1 cut(s) 704
BseBI CCWGG 3 cut(s) 118, 633, 644
BseDI CCNNGG 1 cut(s) 642
BseGI GGATG 3 cut(s) 94, 477, 700
BseMII CTCAG 2 cut(s) 281, 494
BseNI ACTGG 1 cut(s) 704
BseXI GCAGC 5 cut(s) 180, 283, 311, 488, 655
BseYI CCCAGC 1 cut(s) 530
BsgI GTGCAG 1 cut(s) 329
BshFI GGCC 1 cut(s) 116
BsiHKAI GWGCWC 2 cut(s) 268, 402
BsiHKCI CYCGRG 1 cut(s) 717
BsnI GGCC 1 cut(s) 116
BsoBI CYCGRG 1 cut(s) 717
Bsp1286I GDGCHC 2 cut(s) 268, 402
Bsp143I GATC 2 cut(s) 157, 259
BspACI CCGC 2 cut(s) 19, 638
BspANI GGCC 1 cut(s) 116
BspCNI CTCAG 2 cut(s) 280, 493
BspMAI CTGCAG 1 cut(s) 301
BspOI GCTAGC 1 cut(s) 200
BsrBI CCGCTC 1 cut(s) 19
BsrI ACTGG 1 cut(s) 704
BssECI CCNNGG 1 cut(s) 642
BssMI GATC 2 cut(s) 157, 259
Bst2UI CCWGG 3 cut(s) 118, 633, 644
Bst4CI ACNGT 1 cut(s) 620
Bst6I CTCTTC 3 cut(s) 96, 180, 607
BstAPI GCANNNNNTGC 1 cut(s) 350
BstC8I GCNNGC 2 cut(s) 198, 727
BstDEI CTNAG 2 cut(s) 267, 480
BstEII GGTNACC 1 cut(s) 504
BstF5I GGATG 3 cut(s) 94, 477, 700
BstKTI GATC 2 cut(s) 160, 262
BstMBI GATC 2 cut(s) 157, 259
BstMWI GCNNNNNNNGC 4 cut(s) 25, 272, 350, 637
BstNI CCWGG 3 cut(s) 118, 633, 644
BstNSI RCATGY 1 cut(s) 342
BstPI GGTNACC 1 cut(s) 504
BstSCI CCNGG 3 cut(s) 116, 631, 642
BstSFI CTRYAG 1 cut(s) 297
BstV1I GCAGC 5 cut(s) 180, 283, 311, 488, 655
BsuRI GGCC 1 cut(s) 116
BtsCI GGATG 3 cut(s) 94, 477, 700
BtsIMutI CAGTG 1 cut(s) 625
Cac8I GCNNGC 2 cut(s) 198, 727
Cfr13I GGNCC 2 cut(s) 425, 635
Csp6I GTAC 1 cut(s) 610
CspCI CAANNNNNGTGG 2 cut(s) 601, 636
CviAII CATG 6 cut(s) 339, 395, 514, 586, 606, 690
CviQI GTAC 1 cut(s) 610
DdeI CTNAG 2 cut(s) 267, 480
DpnI GATC 2 cut(s) 159, 261
DpnII GATC 2 cut(s) 157, 259
DrdI GACNNNNNNGTC 1 cut(s) 432
DseDI GACNNNNNNGTC 1 cut(s) 432
Eam1104I CTCTTC 3 cut(s) 96, 180, 607
EarI CTCTTC 3 cut(s) 96, 180, 607
Eco147I AGGCCT 1 cut(s) 116
Eco47I GGWCC 2 cut(s) 425, 635
Eco57I CTGAAG 2 cut(s) 297, 557
Eco88I CYCGRG 1 cut(s) 717
Eco91I GGTNACC 1 cut(s) 504
EcoO65I GGTNACC 1 cut(s) 504
EcoRII CCWGG 3 cut(s) 116, 631, 642
EcoT22I ATGCAT 1 cut(s) 396
FaeI CATG 6 cut(s) 342, 398, 517, 589, 609, 693
FaiI YATR 9 cut(s) 315, 340, 396, 452, 501, 515, 587, 607, 691
FalI AAGNNNNNCTT 2 cut(s) 237, 269
FatI CATG 6 cut(s) 338, 394, 513, 585, 605, 689
Fnu4HI GCNGC 5 cut(s) 194, 297, 300, 477, 669
FokI GGATG 3 cut(s) 101, 484, 707
Fsp4HI GCNGC 5 cut(s) 194, 297, 300, 477, 669
FspBI CTAG 3 cut(s) 36, 197, 495
GluI GCNGC 5 cut(s) 194, 297, 300, 477, 669
GsaI CCCAGC 1 cut(s) 534
HaeIII GGCC 1 cut(s) 116
Hin1II CATG 6 cut(s) 342, 398, 517, 589, 609, 693
HincII GTYRAC 1 cut(s) 54
HindII GTYRAC 1 cut(s) 54
HindIII AAGCTT 1 cut(s) 279
HphI GGTGA 1 cut(s) 733
Hpy166II GTNNAC 3 cut(s) 54, 123, 320
Hpy188I TCNGA 1 cut(s) 270
Hpy188III TCNNGA 3 cut(s) 245, 254, 674
Hpy8I GTNNAC 3 cut(s) 54, 123, 320
HpyAV CCTTC 3 cut(s) 172, 362, 532
HpyCH4III ACNGT 1 cut(s) 620
HpyCH4V TGCA 5 cut(s) 299, 310, 344, 353, 394
HpyF10VI GCNNNNNNNGC 4 cut(s) 25, 272, 350, 637
HpyF3I CTNAG 2 cut(s) 267, 480
Hsp92II CATG 6 cut(s) 342, 398, 517, 589, 609, 693
Kzo9I GATC 2 cut(s) 157, 259
Lsp1109I GCAGC 5 cut(s) 180, 283, 311, 488, 655
LweI GCATC 4 cut(s) 180, 295, 381, 655
MaeI CTAG 3 cut(s) 36, 197, 495
MaeIII GTNAC 2 cut(s) 384, 504
MalI GATC 2 cut(s) 159, 261
MbiI CCGCTC 1 cut(s) 19
MboI GATC 2 cut(s) 157, 259
MboII GAAGA 8 cut(s) 89, 113, 194, 197, 594, 602, 659, 668
MhlI GDGCHC 2 cut(s) 268, 402
MluCI AATT 1 cut(s) 236
Mph1103I ATGCAT 1 cut(s) 396
MseI TTAA 2 cut(s) 204, 579
MslI CAYNNNNRTG 1 cut(s) 291
MspR9I CCNGG 3 cut(s) 118, 633, 644
MvaI CCWGG 3 cut(s) 118, 633, 644
MwoI GCNNNNNNNGC 4 cut(s) 25, 272, 350, 637
NdeII GATC 2 cut(s) 157, 259
NheI GCTAGC 1 cut(s) 196
NlaIII CATG 6 cut(s) 342, 398, 517, 589, 609, 693
NmuCI GTSAC 1 cut(s) 384
NsiI ATGCAT 1 cut(s) 396
NspI RCATGY 1 cut(s) 342
PaeR7I CTCGAG 1 cut(s) 717
PceI AGGCCT 1 cut(s) 116
PciI ACATGT 1 cut(s) 338
PkrI GCNGC 5 cut(s) 195, 298, 301, 478, 670
PscI ACATGT 1 cut(s) 338
Psp6I CCWGG 3 cut(s) 116, 631, 642
PspEI GGTNACC 1 cut(s) 504
PspFI CCCAGC 1 cut(s) 530
PspGI CCWGG 3 cut(s) 116, 631, 642
PspPI GGNCC 2 cut(s) 425, 635
PspXI VCTCGAGB 1 cut(s) 717
PstI CTGCAG 1 cut(s) 301
RsaI GTAC 1 cut(s) 611
RsaNI GTAC 1 cut(s) 610
RseI CAYNNNNRTG 1 cut(s) 291
SaqAI TTAA 2 cut(s) 204, 579
SatI GCNGC 5 cut(s) 194, 297, 300, 477, 669
Sau3AI GATC 2 cut(s) 157, 259
Sau96I GGNCC 2 cut(s) 425, 635
ScrFI CCNGG 3 cut(s) 118, 633, 644
SduI GDGCHC 2 cut(s) 268, 402
SfaNI GCATC 4 cut(s) 180, 295, 381, 655
SfcI CTRYAG 1 cut(s) 297
Sfr274I CTCGAG 1 cut(s) 717
SinI GGWCC 2 cut(s) 425, 635
SlaI CTCGAG 1 cut(s) 717
SmiMI CAYNNNNRTG 1 cut(s) 291
SmlI CTYRAG 3 cut(s) 303, 672, 717
SmoI CTYRAG 3 cut(s) 303, 672, 717
Sse9I AATT 1 cut(s) 236
SseBI AGGCCT 1 cut(s) 116
SsiI CCGC 2 cut(s) 19, 638
SspMI CTAG 3 cut(s) 36, 197, 495
StuI AGGCCT 1 cut(s) 116
StyD4I CCNGG 3 cut(s) 116, 631, 642
TaaI ACNGT 1 cut(s) 620
TaqI TCGA 1 cut(s) 718
TasI AATT 1 cut(s) 236
Tru1I TTAA 2 cut(s) 204, 579
Tru9I TTAA 2 cut(s) 204, 579
TscAI CASTG 1 cut(s) 625
TseFI GTSAC 1 cut(s) 384
TseI GCWGC 5 cut(s) 193, 296, 299, 476, 668
Tsp45I GTSAC 1 cut(s) 384
TspDTI ATGAA 5 cut(s) 17, 90, 569, 594, 669
TspRI CASTG 1 cut(s) 625
VpaK11BI GGWCC 2 cut(s) 425, 635
XapI RAATTY 1 cut(s) 236
XceI RCATGY 1 cut(s) 342
XhoI CTCGAG 1 cut(s) 717
XspI CTAG 3 cut(s) 36, 197, 495
Zsp2I ATGCAT 1 cut(s) 396
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.