Rmu_sc0006697.1_g000004

BTB POZ domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006697.1
OG0018215
Physical Location & Seq
Reverse (-)
7460 .. 7828
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006697.1_g000004.1.cds

Sequence Viewer

Length: 369 bp
atggctgaaattagacttacaaaggtagaacaaggccaaaccaagattagaaatgttctgattgccgtaacccctgaaggtttttggtgttgtccttctcctcttgggtttcaaaagacccttaaggctcataactctctacacaaacccaagtcctcatcaccaccaccacctccaccacccaagacaacagctcacaaaaaacaaactatactaaatgaaaagaagccaactttcgggccatctagatctgtttctgatggtcaaaggactcttggtccggaggcgccagaggcacctgccctcagtgcatctttggttgcagagagagtttcgaggcccaaagttgaaaatttgtcgaggaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BTB

Protein Analysis

122

Amino Acids

13.25

Weight (kDa)

10.15

Isoelectric Point (pI)

63.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 307
Acc36I ACCTGC 1 cut(s) 307
AccB1I GGYRCC 2 cut(s) 286, 295
AccIII TCCGGA 1 cut(s) 280
AcsI RAATTY 1 cut(s) 352
AcuI CTGAAG 1 cut(s) 96
AcyI GRCGYC 1 cut(s) 287
AfiI CCNNNNNNNGG 1 cut(s) 236
AflII CTTAAG 1 cut(s) 122
AgsI TTSAA 2 cut(s) 113, 350
AhdI GACNNNNNGTC 1 cut(s) 276
AluBI AGCT 1 cut(s) 194
AluI AGCT 1 cut(s) 194
Aor13HI TCCGGA 1 cut(s) 280
AoxI GGCC 3 cut(s) 34, 239, 338
ApoI RAATTY 1 cut(s) 352
AspLEI GCGC 1 cut(s) 289
AspS9I GGNCC 3 cut(s) 239, 278, 339
AsuHPI GGTGA 1 cut(s) 153
AvaII GGWCC 1 cut(s) 278
BanI GGYRCC 2 cut(s) 286, 295
BccI CCATC 2 cut(s) 250, 254
BceAI ACGGC 1 cut(s) 50
BfaI CTAG 2 cut(s) 246, 367
BfoI RGCGCY 1 cut(s) 290
BfrI CTTAAG 1 cut(s) 122
BfuAI ACCTGC 1 cut(s) 307
BglII AGATCT 1 cut(s) 248
Bme18I GGWCC 1 cut(s) 278
BmeRI GACNNNNNGTC 1 cut(s) 276
BmgT120I GGNCC 3 cut(s) 239, 278, 339
BmiI GGNNCC 2 cut(s) 288, 297
BmsI GCATC 1 cut(s) 320
BsaHI GRCGYC 1 cut(s) 287
BsaWI WCCGGW 1 cut(s) 280
Bsc4I CCNNNNNNNGG 1 cut(s) 236
BseAI TCCGGA 1 cut(s) 280
BseLI CCNNNNNNNGG 1 cut(s) 236
BseMII CTCAG 1 cut(s) 319
BseRI GAGGAG 1 cut(s) 90
BshFI GGCC 3 cut(s) 36, 241, 340
BshNI GGYRCC 2 cut(s) 286, 295
BsiSI CCGG 1 cut(s) 281
BslI CCNNNNNNNGG 1 cut(s) 236
BsnI GGCC 3 cut(s) 36, 241, 340
Bsp13I TCCGGA 1 cut(s) 280
Bsp143I GATC 1 cut(s) 248
BspANI GGCC 3 cut(s) 36, 241, 340
BspCNI CTCAG 1 cut(s) 318
BspEI TCCGGA 1 cut(s) 280
BspLI GGNNCC 2 cut(s) 288, 297
BspMI ACCTGC 1 cut(s) 307
BspT107I GGYRCC 2 cut(s) 286, 295
BspTI CTTAAG 1 cut(s) 122
BssMI GATC 1 cut(s) 248
BssNI GRCGYC 1 cut(s) 287
BstACI GRCGYC 1 cut(s) 287
BstAFI CTTAAG 1 cut(s) 122
BstDEI CTNAG 1 cut(s) 305
BstH2I RGCGCY 1 cut(s) 290
BstHHI GCGC 1 cut(s) 289
BstKTI GATC 1 cut(s) 251
BstMBI GATC 1 cut(s) 248
BstMWI GCNNNNNNNGC 2 cut(s) 293, 308
BstX2I RGATCY 1 cut(s) 248
BstYI RGATCY 1 cut(s) 248
BsuRI GGCC 3 cut(s) 36, 241, 340
BtsIMutI CAGTG 1 cut(s) 313
BveI ACCTGC 1 cut(s) 307
CfoI GCGC 1 cut(s) 289
Cfr13I GGNCC 3 cut(s) 239, 278, 339
CviJI RGCY 7 cut(s) 5, 36, 128, 194, 229, 241, 340
CviKI_1 RGCY 7 cut(s) 5, 36, 128, 194, 229, 241, 340
DdeI CTNAG 1 cut(s) 305
DinI GGCGCC 1 cut(s) 288
DpnI GATC 1 cut(s) 250
DpnII GATC 1 cut(s) 248
DriI GACNNNNNGTC 1 cut(s) 276
Eam1105I GACNNNNNGTC 1 cut(s) 276
Eco47I GGWCC 1 cut(s) 278
Eco57I CTGAAG 1 cut(s) 96
EgeI GGCGCC 1 cut(s) 288
EheI GGCGCC 1 cut(s) 288
FaiI YATR 2 cut(s) 132, 212
FspBI CTAG 2 cut(s) 246, 367
GlaI GCGC 1 cut(s) 288
HaeII RGCGCY 1 cut(s) 290
HaeIII GGCC 3 cut(s) 36, 241, 340
HapII CCGG 1 cut(s) 281
HhaI GCGC 1 cut(s) 289
Hin1I GRCGYC 1 cut(s) 287
Hin6I GCGC 1 cut(s) 287
HinP1I GCGC 1 cut(s) 287
HinfI GANTC 1 cut(s) 271
HpaII CCGG 1 cut(s) 281
HphI GGTGA 1 cut(s) 153
Hpy188I TCNGA 2 cut(s) 60, 259
Hpy188III TCNNGA 2 cut(s) 246, 281
HpyAV CCTTC 2 cut(s) 71, 105
HpyCH4V TGCA 2 cut(s) 311, 323
HpyF10VI GCNNNNNNNGC 2 cut(s) 293, 308
HpyF3I CTNAG 1 cut(s) 305
Hsp92I GRCGYC 1 cut(s) 287
HspAI GCGC 1 cut(s) 287
KasI GGCGCC 1 cut(s) 286
Kpn2I TCCGGA 1 cut(s) 280
Kzo9I GATC 1 cut(s) 248
LpnPI CCDG 4 cut(s) 87, 294, 303, 312
LweI GCATC 1 cut(s) 320
MaeI CTAG 2 cut(s) 246, 367
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 250
MboI GATC 1 cut(s) 248
MflI RGATCY 1 cut(s) 248
MluCI AATT 2 cut(s) 9, 352
Mly113I GGCGCC 1 cut(s) 287
MlyI GAGTC 1 cut(s) 265
MnlI CCTC 8 cut(s) 111, 166, 183, 277, 286, 314, 330, 354
MroI TCCGGA 1 cut(s) 280
MseI TTAA 1 cut(s) 123
MspCI CTTAAG 1 cut(s) 122
MspI CCGG 1 cut(s) 281
MwoI GCNNNNNNNGC 2 cut(s) 293, 308
NarI GGCGCC 1 cut(s) 287
NdeII GATC 1 cut(s) 248
NlaIV GGNNCC 2 cut(s) 288, 297
PaqCI CACCTGC 1 cut(s) 307
PleI GAGTC 1 cut(s) 265
PluTI GGCGCC 1 cut(s) 290
PpsI GAGTC 1 cut(s) 265
PspN4I GGNNCC 2 cut(s) 288, 297
PspPI GGNCC 3 cut(s) 239, 278, 339
PsuI RGATCY 1 cut(s) 248
SaqAI TTAA 1 cut(s) 123
Sau3AI GATC 1 cut(s) 248
Sau96I GGNCC 3 cut(s) 239, 278, 339
SchI GAGTC 1 cut(s) 265
SetI ASST 5 cut(s) 27, 82, 175, 196, 301
SfaNI GCATC 1 cut(s) 320
SfoI GGCGCC 1 cut(s) 288
SinI GGWCC 1 cut(s) 278
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
Sse9I AATT 2 cut(s) 9, 352
SspDI GGCGCC 1 cut(s) 286
SspMI CTAG 2 cut(s) 246, 367
TaqI TCGA 2 cut(s) 335, 359
TasI AATT 2 cut(s) 9, 352
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TscAI CASTG 1 cut(s) 313
TspDTI ATGAA 1 cut(s) 234
TspRI CASTG 1 cut(s) 313
Vha464I CTTAAG 1 cut(s) 122
VpaK11BI GGWCC 1 cut(s) 278
XapI RAATTY 1 cut(s) 352
XbaI TCTAGA 1 cut(s) 245
XspI CTAG 2 cut(s) 246, 367
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.