Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006986.1

Orthogroup ID

OG0014863

Physical Location & Seq

Genomic Coordinates Forward (+)

8867 .. 9166

Gene Structure 300 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006986.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

atgtcgtcattccccgtcgtcaagcacgtcgtcctcttcaaggtcaaagacaacaccaatccctccaaggtcaacggctgctcagatccgtcgtgtccctctatcattttgtcgcatctgggttccgggtcggataaagagaatctcagcctctttatctgggacctcttcactcggctaaaaattagctgcatcgagttcaagaagaaggctttggagtctcagcttcagcttcttgaagacgacgacaaggtcgcctgcttgacaatgtcgtcgatgggatttaatcggcaactttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Arm

Protein Analysis

99

Amino Acids

11.05

Weight (kDa)

7.66

Isoelectric Point (pI)

50.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014863)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr7g0211441
rosa_laevigata	RLG00000020728
rosa_multiflora	Rmu_sc0002709.1_g000026 Rmu_sc0004199.1_g000043 Rmu_sc0006986.1_g000001 Rmu_sc0028901.1_g000002
rosa_samantha	Rh1AG349000 Rh1AG369300 Rh1BG138000 Rh2BG344400 Rh3CG285500 Rh3DG281100 Rh4BG126100 Rh6CG232400 Rh7AG458300 Rh7DG248200 Rh7DG263600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	251, 271
AclWI	GGATC	1 cut(s)	80
AcuI	CTGAAG	1 cut(s)	212
AfiI	CCNNNNNNNGG	1 cut(s)	40
AgsI	TTSAA	3 cut(s)	40, 202, 239
AjiI	CACGTC	1 cut(s)	28
AjuI	GAANNNNNNNTTGG	2 cut(s)	197, 229
AluBI	AGCT	3 cut(s)	189, 226, 232
AluI	AGCT	3 cut(s)	189, 226, 232
Alw26I	GTCTC	1 cut(s)	225
AlwI	GGATC	1 cut(s)	80
ApeKI	GCWGC	2 cut(s)	78, 189
AspS9I	GGNCC	1 cut(s)	163
AsuC2I	CCSGG	1 cut(s)	127
AvaII	GGWCC	1 cut(s)	163
BbsI	GAAGAC	1 cut(s)	246
BbvI	GCAGC	2 cut(s)	65, 176
BccI	CCATC	1 cut(s)	271
BceAI	ACGGC	1 cut(s)	91
BcnI	CCSGG	1 cut(s)	127
BcoDI	GTCTC	1 cut(s)	225
BisI	GCNGC	2 cut(s)	79, 190
BlsI	GCNGC	2 cut(s)	80, 191
Bme1390I	CCNGG	1 cut(s)	127
Bme18I	GGWCC	1 cut(s)	163
BmgBI	CACGTC	1 cut(s)	28
BmgT120I	GGNCC	1 cut(s)	163
BmiI	GGNNCC	2 cut(s)	124, 164
BmrFI	CCNGG	1 cut(s)	127
BmsI	GCATC	2 cut(s)	124, 201
BpiI	GAAGAC	1 cut(s)	246
BpuMI	CCSGG	1 cut(s)	127
BsaJI	CCNNGG	1 cut(s)	66
Bsc4I	CCNNNNNNNGG	1 cut(s)	40
BseDI	CCNNGG	1 cut(s)	66
BseLI	CCNNNNNNNGG	1 cut(s)	40
BseMII	CTCAG	3 cut(s)	96, 160, 236
BseXI	GCAGC	2 cut(s)	65, 176
BsiSI	CCGG	1 cut(s)	126
BslFI	GGGAC	2 cut(s)	81, 176
BslI	CCNNNNNNNGG	1 cut(s)	40
BsmAI	GTCTC	1 cut(s)	225
BsmFI	GGGAC	2 cut(s)	81, 176
Bsp143I	GATC	1 cut(s)	85
BspCNI	CTCAG	3 cut(s)	95, 159, 235
BspLI	GGNNCC	2 cut(s)	124, 164
BspPI	GGATC	1 cut(s)	80
BssECI	CCNNGG	1 cut(s)	66
BssMI	GATC	1 cut(s)	85
BssT1I	CCWWGG	1 cut(s)	66
Bst6I	CTCTTC	2 cut(s)	41, 173
BstC8I	GCNNGC	1 cut(s)	259
BstDEI	CTNAG	3 cut(s)	82, 146, 222
BstENI	CCTNNNNNAGG	1 cut(s)	38
BstKTI	GATC	1 cut(s)	88
BstMAI	GTCTC	1 cut(s)	225
BstMBI	GATC	1 cut(s)	85
BstSCI	CCNGG	1 cut(s)	125
BstV1I	GCAGC	2 cut(s)	65, 176
BstV2I	GAAGAC	1 cut(s)	246
BstX2I	RGATCY	1 cut(s)	85
BstYI	RGATCY	1 cut(s)	85
BtrI	CACGTC	1 cut(s)	28
Cac8I	GCNNGC	1 cut(s)	259
Cfr13I	GGNCC	1 cut(s)	163
CviJI	RGCY	7 cut(s)	78, 150, 178, 189, 212, 226, 232
CviKI_1	RGCY	7 cut(s)	78, 150, 178, 189, 212, 226, 232
DdeI	CTNAG	3 cut(s)	82, 146, 222
DpnI	GATC	1 cut(s)	87
DpnII	GATC	1 cut(s)	85
DrdI	GACNNNNNNGTC	2 cut(s)	251, 271
DseDI	GACNNNNNNGTC	2 cut(s)	251, 271
Eam1104I	CTCTTC	2 cut(s)	41, 173
EarI	CTCTTC	2 cut(s)	41, 173
Eco130I	CCWWGG	1 cut(s)	66
Eco47I	GGWCC	1 cut(s)	163
Eco57I	CTGAAG	1 cut(s)	212
EcoNI	CCTNNNNNAGG	1 cut(s)	38
EcoO109I	RGGNCCY	1 cut(s)	163
EcoT14I	CCWWGG	1 cut(s)	66
ErhI	CCWWGG	1 cut(s)	66
FaqI	GGGAC	2 cut(s)	81, 176
Fnu4HI	GCNGC	2 cut(s)	79, 190
Fsp4HI	GCNGC	2 cut(s)	79, 190
GluI	GCNGC	2 cut(s)	79, 190
HapII	CCGG	1 cut(s)	126
HincII	GTYRAC	1 cut(s)	73
HindII	GTYRAC	1 cut(s)	73
HinfI	GANTC	2 cut(s)	142, 218
HpaII	CCGG	1 cut(s)	126
Hpy166II	GTNNAC	1 cut(s)	73
Hpy188I	TCNGA	2 cut(s)	85, 133
Hpy188III	TCNNGA	2 cut(s)	202, 236
Hpy8I	GTNNAC	1 cut(s)	73
Hpy99I	CGWCG	5 cut(s)	20, 32, 94, 248, 277
HpyAV	CCTTC	1 cut(s)	202
HpyCH4IV	ACGT	1 cut(s)	27
HpyCH4V	TGCA	1 cut(s)	192
HpyF3I	CTNAG	3 cut(s)	82, 146, 222
HpySE526I	ACGT	1 cut(s)	27
Kzo9I	GATC	1 cut(s)	85
LpnPI	CCDG	4 cut(s)	104, 139, 145, 271
Lsp1109I	GCAGC	2 cut(s)	65, 176
LweI	GCATC	2 cut(s)	124, 201
MaeII	ACGT	1 cut(s)	27
MalI	GATC	1 cut(s)	87
MboI	GATC	1 cut(s)	85
MboII	GAAGA	4 cut(s)	28, 160, 217, 251
MflI	RGATCY	1 cut(s)	85
MluCI	AATT	1 cut(s)	183
MlyI	GAGTC	1 cut(s)	227
MmeI	TCCRAC	1 cut(s)	111
MnlI	CCTC	5 cut(s)	44, 73, 109, 161, 176
MseI	TTAA	2 cut(s)	285, 298
MspI	CCGG	1 cut(s)	126
MspR9I	CCNGG	1 cut(s)	127
NciI	CCSGG	1 cut(s)	127
NdeII	GATC	1 cut(s)	85
NlaIV	GGNNCC	2 cut(s)	124, 164
NmeAIII	GCCGAG	1 cut(s)	154
PcsI	WCGNNNNNNNCGW	1 cut(s)	24
PfeI	GAWTC	1 cut(s)	142
PflFI	GACNNNGTC	2 cut(s)	251, 268
PkrI	GCNGC	2 cut(s)	80, 191
PleI	GAGTC	1 cut(s)	226
PpsI	GAGTC	1 cut(s)	226
PpuMI	RGGWCCY	1 cut(s)	163
Psp5II	RGGWCCY	1 cut(s)	163
PspN4I	GGNNCC	2 cut(s)	124, 164
PspPI	GGNCC	1 cut(s)	163
PspPPI	RGGWCCY	1 cut(s)	163
PsuI	RGATCY	1 cut(s)	85
PsyI	GACNNNGTC	2 cut(s)	251, 268
SaqAI	TTAA	2 cut(s)	285, 298
SatI	GCNGC	2 cut(s)	79, 190
Sau3AI	GATC	1 cut(s)	85
Sau96I	GGNCC	1 cut(s)	163
SchI	GAGTC	1 cut(s)	227
ScrFI	CCNGG	1 cut(s)	127
SetI	ASST	8 cut(s)	30, 45, 72, 168, 191, 228, 234, 255
SfaNI	GCATC	2 cut(s)	124, 201
SinI	GGWCC	1 cut(s)	163
Sse9I	AATT	1 cut(s)	183
StyD4I	CCNGG	1 cut(s)	125
StyI	CCWWGG	1 cut(s)	66
TaiI	ACGT	1 cut(s)	30
TaqI	TCGA	2 cut(s)	195, 275
TasI	AATT	1 cut(s)	183
TfiI	GAWTC	1 cut(s)	142
Tru1I	TTAA	2 cut(s)	285, 298
Tru9I	TTAA	2 cut(s)	285, 298
TseI	GCWGC	2 cut(s)	78, 189
TspGWI	ACGGA	1 cut(s)	78
Tth111I	GACNNNGTC	2 cut(s)	251, 268
VpaK11BI	GGWCC	1 cut(s)	163
XagI	CCTNNNNNAGG	1 cut(s)	38

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.