Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007205.1

Orthogroup ID

OG0015355

Physical Location & Seq

Genomic Coordinates Reverse (-)

1770 .. 2782

Gene Structure 1013 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007205.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 489 bp

atggcggcaacatcaacttctaccctgccatttttctcctctcccacaactaaccctcataaacccattaaaacccttcaatctcccaactttgtcagacccttttctgcttccaagagaaacagcttaagaatttcccatgtgagagctgtagcaccgaagcttgcccgcaaagctttggctgtttctgggttgatgaggggcagcgattctgaaacagacgcagaattggaacagaacaatctgaattcggatgccaccattgacctacaactcccaagaagaagcctgctagtaaagtttacttgtgatttgtgtaatgaaagaacaagcaaactcgttaaccgattggcatatgaaaaggggcttatttatgtgcagtgtgcagggtgtctcaagtatcacaagttagttgataatcttggccttgtggttgagtatgacttaagaggggatatcgatttggactcaaatgcagatgaagtttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005739 GO:0006457 GO:0006605 GO:0006626 GO:0006810 GO:0006839 GO:0006886 GO:0006996 GO:0007005 GO:0008104 GO:0008150 GO:0009987 GO:0015031 GO:0015833 GO:0016043 GO:0017038 GO:0030150 GO:0031647 GO:0031974 GO:0031981 GO:0033036 GO:0033365 GO:0034613 GO:0042886 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0044743 GO:0045184 GO:0046907 GO:0050821 GO:0051087 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0055085 GO:0065002 GO:0065007 GO:0065008 GO:0070013 GO:0070585 GO:0070727 GO:0071702 GO:0071705 GO:0071806 GO:0071840 GO:0072594 GO:0072655 GO:1990542

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-DNL

Protein Analysis

162

Amino Acids

17.91

Weight (kDa)

8.7

Isoelectric Point (pI)

44.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015355)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G68730
fragaria_vesca	FvH4_4g28420
malus_domestica	MD13G1049900.v1.1 MD16G1050900.v1.1
prunus_persica	Prupe.1G301800_v2.0.a1
pyrus_communis	pycom16g04460
rosa_chinensis	RchiOBHm_Chr4g0436371
rosa_laevigata	RLG00000006524
rosa_multiflora	Rmu_sc0007205.1_g000002
rosa_roxburghii	Rroxscaffold_5G00377540
rosa_rugosa	Rorug04G0293300
rosa_samantha	Rh4AG347600 Rh4BG356400 Rh4CG371000 Rh4DG350100
rosa_wichuraiana	Rw4G030390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	5, 169
AcsI	RAATTY	2 cut(s)	132, 247
AflII	CTTAAG	2 cut(s)	127, 445
AgsI	TTSAA	1 cut(s)	80
AluBI	AGCT	4 cut(s)	126, 149, 163, 176
AluI	AGCT	4 cut(s)	126, 149, 163, 176
Alw26I	GTCTC	1 cut(s)	398
AoxI	GGCC	1 cut(s)	424
ApeKI	GCWGC	1 cut(s)	204
ApoI	RAATTY	2 cut(s)	132, 247
BbvI	GCAGC	1 cut(s)	216
BcoDI	GTCTC	1 cut(s)	398
BfaI	CTAG	1 cut(s)	293
BfmI	CTRYAG	1 cut(s)	150
BfrI	CTTAAG	2 cut(s)	127, 445
BisI	GCNGC	2 cut(s)	6, 205
BlsI	GCNGC	2 cut(s)	7, 206
BmsI	GCATC	1 cut(s)	244
BpuEI	CTTGAG	1 cut(s)	380
Bsa29I	ATCGAT	1 cut(s)	459
BseCI	ATCGAT	1 cut(s)	459
BseGI	GGATG	1 cut(s)	259
BseRI	GAGGAG	1 cut(s)	28
BseXI	GCAGC	1 cut(s)	216
BsgI	GTGCAG	2 cut(s)	398, 405
BshFI	GGCC	1 cut(s)	426
BshVI	ATCGAT	1 cut(s)	459
BsmAI	GTCTC	1 cut(s)	398
BsnI	GGCC	1 cut(s)	426
BspACI	CCGC	2 cut(s)	5, 169
BspANI	GGCC	1 cut(s)	426
BspDI	ATCGAT	1 cut(s)	459
BspTI	CTTAAG	2 cut(s)	127, 445
BstAFI	CTTAAG	2 cut(s)	127, 445
BstC8I	GCNNGC	3 cut(s)	165, 169, 290
BstF5I	GGATG	1 cut(s)	259
BstMAI	GTCTC	1 cut(s)	398
BstMWI	GCNNNNNNNGC	1 cut(s)	173
BstSFI	CTRYAG	1 cut(s)	150
BstV1I	GCAGC	1 cut(s)	216
Bsu15I	ATCGAT	1 cut(s)	459
BsuRI	GGCC	1 cut(s)	426
BsuTUI	ATCGAT	1 cut(s)	459
BtsCI	GGATG	1 cut(s)	259
BtsI	GCAGTG	1 cut(s)	386
BtsIMutI	CAGTG	1 cut(s)	386
Cac8I	GCNNGC	3 cut(s)	165, 169, 290
ClaI	ATCGAT	1 cut(s)	459
CseI	GACGC	1 cut(s)	230
CviAII	CATG	1 cut(s)	140
CviJI	RGCY	8 cut(s)	126, 149, 163, 176, 182, 288, 367, 426
CviKI_1	RGCY	8 cut(s)	126, 149, 163, 176, 182, 288, 367, 426
Eco32I	GATATC	1 cut(s)	457
EcoRI	GAATTC	1 cut(s)	247
EcoRV	GATATC	1 cut(s)	457
FaeI	CATG	1 cut(s)	143
FaiI	YATR	6 cut(s)	60, 141, 355, 357, 375, 441
FatI	CATG	1 cut(s)	139
FauI	CCCGC	1 cut(s)	176
FauNDI	CATATG	1 cut(s)	355
Fnu4HI	GCNGC	2 cut(s)	6, 205
FokI	GGATG	1 cut(s)	266
Fsp4HI	GCNGC	2 cut(s)	6, 205
FspBI	CTAG	1 cut(s)	293
GluI	GCNGC	2 cut(s)	6, 205
HaeIII	GGCC	1 cut(s)	426
HgaI	GACGC	1 cut(s)	230
Hin1II	CATG	1 cut(s)	143
HincII	GTYRAC	1 cut(s)	343
HindII	GTYRAC	1 cut(s)	343
HindIII	AAGCTT	2 cut(s)	161, 174
HinfI	GANTC	2 cut(s)	209, 467
HpaI	GTTAAC	1 cut(s)	343
Hpy166II	GTNNAC	2 cut(s)	303, 343
Hpy188I	TCNGA	4 cut(s)	98, 214, 246, 253
Hpy8I	GTNNAC	2 cut(s)	303, 343
HpyAV	CCTTC	1 cut(s)	86
HpyCH4V	TGCA	3 cut(s)	379, 386, 476
HpyF10VI	GCNNNNNNNGC	1 cut(s)	173
Hsp92II	CATG	1 cut(s)	143
KspAI	GTTAAC	1 cut(s)	343
LpnPI	CCDG	4 cut(s)	38, 174, 302, 372
Lsp1109I	GCAGC	1 cut(s)	216
LweI	GCATC	1 cut(s)	244
MaeI	CTAG	1 cut(s)	293
MboII	GAAGA	1 cut(s)	294
MluCI	AATT	3 cut(s)	132, 227, 247
MlyI	GAGTC	1 cut(s)	461
MnlI	CCTC	4 cut(s)	49, 66, 192, 443
MseI	TTAA	4 cut(s)	69, 128, 342, 446
MspCI	CTTAAG	2 cut(s)	127, 445
MwoI	GCNNNNNNNGC	1 cut(s)	173
NdeI	CATATG	1 cut(s)	355
NlaIII	CATG	1 cut(s)	143
PfeI	GAWTC	1 cut(s)	209
PkrI	GCNGC	2 cut(s)	7, 206
PleI	GAGTC	1 cut(s)	461
PpsI	GAGTC	1 cut(s)	461
SaqAI	TTAA	4 cut(s)	69, 128, 342, 446
SatI	GCNGC	2 cut(s)	6, 205
SchI	GAGTC	1 cut(s)	461
SetI	ASST	5 cut(s)	128, 151, 165, 178, 270
SfaNI	GCATC	1 cut(s)	244
SfcI	CTRYAG	1 cut(s)	150
SmlI	CTYRAG	3 cut(s)	127, 395, 445
SmoI	CTYRAG	3 cut(s)	127, 395, 445
Sse9I	AATT	3 cut(s)	132, 227, 247
SsiI	CCGC	2 cut(s)	5, 169
SspMI	CTAG	1 cut(s)	293
TaqI	TCGA	1 cut(s)	459
TasI	AATT	3 cut(s)	132, 227, 247
TauI	GCSGC	1 cut(s)	8
TfiI	GAWTC	1 cut(s)	209
Tru1I	TTAA	4 cut(s)	69, 128, 342, 446
Tru9I	TTAA	4 cut(s)	69, 128, 342, 446
TscAI	CASTG	1 cut(s)	386
TseI	GCWGC	1 cut(s)	204
TspDTI	ATGAA	2 cut(s)	336, 372
TspRI	CASTG	1 cut(s)	386
Vha464I	CTTAAG	2 cut(s)	127, 445
XapI	RAATTY	2 cut(s)	132, 247
XspI	CTAG	1 cut(s)	293

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.