Rmu_sc0007209.1_g000006

ubiquitin-like protein ligase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007209.1
Physical Location & Seq
Forward (+)
32410 .. 34412
2003 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007209.1_g000006.1.cds

Sequence Viewer

Length: 720 bp
atggacgccttagttaagcttggttataaagaagttgaaggcgagtttttgtacacttcaagctctgtggggagattcaacgtttgggctaccttttcagtcaaaaatcgtgggattgctatattttatggtggcaagagtcgaatgaatgtccagggcaaggaaccagatgtgtatttcgcatggggcaaggctactttcaagcaggaaggatctgtgttacggatcaaagatggattggagacttccttgctggaaccagcagaacctccatatttgggtagcaaagagatattctactggttttgcaaccagttaaatgaggctattggtttgggttctgtggtggatgatggctttgatctctcggatatagagatggcactcaaagcttcactggaccattttggacagccatcttcacagccttcattggctattggtttgggttctgtggtggatgatggctttgatccctctgatatagagatggcactcaaagcttcattggaccattttggacagacatctttacagccttctgcaccacctttgcccgaagatgactgcaccatttgttttggtcatagagttgacactgcctttgttccctgcggtcatcttatttgctcaccatgtgcagaaaagattcagcatcagaacatgcggtgtcccttctgccgtgaggtggtgaagaactttgcaattcctaggatttga

Protein Analysis

239

Amino Acids

26.28

Weight (kDa)

4.95

Isoelectric Point (pI)

33.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 27
AciI CCGC 2 cut(s) 615, 667
AclI AACGTT 1 cut(s) 81
AclWI GGATC 3 cut(s) 220, 233, 467
AcyI GRCGYC 1 cut(s) 6
AdeI CACNNNGTG 1 cut(s) 638
AfaI GTAC 1 cut(s) 53
AfiI CCNNNNNNNGG 3 cut(s) 160, 278, 688
AgsI TTSAA 4 cut(s) 38, 60, 79, 202
AjnI CCWGG 1 cut(s) 153
AluBI AGCT 4 cut(s) 19, 63, 392, 503
AluI AGCT 4 cut(s) 19, 63, 392, 503
Alw26I GTCTC 1 cut(s) 236
AlwI GGATC 3 cut(s) 220, 233, 467
ArsI GACNNNNNNTTYG 2 cut(s) 587, 619
Asp700I GAANNNNTTC 1 cut(s) 648
AspA2I CCTAGG 1 cut(s) 710
AspS9I GGNCC 2 cut(s) 400, 511
AsuHPI GGTGA 2 cut(s) 624, 703
AvaII GGWCC 2 cut(s) 400, 511
AvrII CCTAGG 1 cut(s) 710
BccI CCATC 6 cut(s) 227, 347, 373, 424, 458, 484
BceAI ACGGC 1 cut(s) 666
BciT130I CCWGG 1 cut(s) 155
BcoDI GTCTC 1 cut(s) 236
BfaI CTAG 1 cut(s) 711
BlnI CCTAGG 1 cut(s) 710
Bme1390I CCNGG 1 cut(s) 155
Bme18I GGWCC 2 cut(s) 400, 511
BmgT120I GGNCC 2 cut(s) 400, 511
BmiI GGNNCC 2 cut(s) 165, 258
BmrFI CCNGG 1 cut(s) 155
BmsI GCATC 1 cut(s) 664
BsaHI GRCGYC 1 cut(s) 6
BsaJI CCNNGG 2 cut(s) 154, 710
Bsc4I CCNNNNNNNGG 3 cut(s) 160, 278, 688
Bse1I ACTGG 3 cut(s) 305, 313, 402
BseBI CCWGG 1 cut(s) 155
BseDI CCNNGG 2 cut(s) 154, 710
BseGI GGATG 2 cut(s) 355, 466
BseLI CCNNNNNNNGG 3 cut(s) 160, 278, 688
BseNI ACTGG 3 cut(s) 305, 313, 402
BsgI GTGCAG 3 cut(s) 528, 553, 660
BslFI GGGAC 1 cut(s) 657
BslI CCNNNNNNNGG 3 cut(s) 160, 278, 688
BsmAI GTCTC 1 cut(s) 236
BsmFI GGGAC 1 cut(s) 657
Bsp1407I TGTACA 1 cut(s) 51
Bsp143I GATC 4 cut(s) 212, 225, 361, 472
BspACI CCGC 2 cut(s) 615, 667
BspLI GGNNCC 2 cut(s) 165, 258
BspPI GGATC 3 cut(s) 220, 233, 467
BsrGI TGTACA 1 cut(s) 51
BsrI ACTGG 3 cut(s) 305, 313, 402
BssECI CCNNGG 2 cut(s) 154, 710
BssMI GATC 4 cut(s) 212, 225, 361, 472
BssNI GRCGYC 1 cut(s) 6
BssT1I CCWWGG 1 cut(s) 710
Bst2UI CCWGG 1 cut(s) 155
BstACI GRCGYC 1 cut(s) 6
BstAUI TGTACA 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 10
BstF5I GGATG 2 cut(s) 355, 466
BstKTI GATC 4 cut(s) 215, 228, 364, 475
BstMAI GTCTC 1 cut(s) 236
BstMBI GATC 4 cut(s) 212, 225, 361, 472
BstMWI GCNNNNNNNGC 2 cut(s) 389, 500
BstNI CCWGG 1 cut(s) 155
BstNSI RCATGY 1 cut(s) 667
BstSCI CCNGG 1 cut(s) 153
BstX2I RGATCY 1 cut(s) 212
BstYI RGATCY 1 cut(s) 212
BtsCI GGATG 2 cut(s) 355, 466
BtsI GCAGTG 1 cut(s) 597
BtsIMutI CAGTG 2 cut(s) 395, 597
Cfr13I GGNCC 2 cut(s) 400, 511
CseI GACGC 1 cut(s) 14
Csp6I GTAC 1 cut(s) 52
CspCI CAANNNNNGTGG 4 cut(s) 48, 83, 91, 126
CviAII CATG 3 cut(s) 183, 636, 664
CviQI GTAC 1 cut(s) 52
DdeI CTNAG 1 cut(s) 10
DpnI GATC 4 cut(s) 214, 227, 363, 474
DpnII GATC 4 cut(s) 212, 225, 361, 472
DraIII CACNNNGTG 1 cut(s) 638
Eco130I CCWWGG 1 cut(s) 710
Eco47I GGWCC 2 cut(s) 400, 511
EcoRII CCWGG 1 cut(s) 153
EcoT14I CCWWGG 1 cut(s) 710
ErhI CCWWGG 1 cut(s) 710
FaeI CATG 3 cut(s) 186, 639, 667
FaqI GGGAC 1 cut(s) 657
FatI CATG 3 cut(s) 182, 635, 663
FokI GGATG 2 cut(s) 362, 473
FspBI CTAG 1 cut(s) 711
HgaI GACGC 1 cut(s) 14
Hin1I GRCGYC 1 cut(s) 6
Hin1II CATG 3 cut(s) 186, 639, 667
HincII GTYRAC 1 cut(s) 595
HindII GTYRAC 1 cut(s) 595
HindIII AAGCTT 3 cut(s) 17, 390, 501
HinfI GANTC 3 cut(s) 75, 139, 649
HphI GGTGA 2 cut(s) 624, 703
Hpy166II GTNNAC 2 cut(s) 54, 595
Hpy188I TCNGA 3 cut(s) 370, 481, 660
Hpy8I GTNNAC 2 cut(s) 54, 595
HpyAV CCTTC 5 cut(s) 32, 203, 438, 549, 685
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 5 cut(s) 309, 545, 570, 641, 704
HpyF10VI GCNNNNNNNGC 2 cut(s) 389, 500
HpyF3I CTNAG 1 cut(s) 10
HpySE526I ACGT 1 cut(s) 81
Hsp92I GRCGYC 1 cut(s) 6
Hsp92II CATG 3 cut(s) 186, 639, 667
Kzo9I GATC 4 cut(s) 212, 225, 361, 472
LweI GCATC 1 cut(s) 664
MaeI CTAG 1 cut(s) 711
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 219
MalI GATC 4 cut(s) 214, 227, 363, 474
MboI GATC 4 cut(s) 212, 225, 361, 472
MboII GAAGA 3 cut(s) 411, 572, 706
MflI RGATCY 1 cut(s) 212
MluCI AATT 1 cut(s) 705
MlyI GAGTC 1 cut(s) 148
MnlI CCTC 4 cut(s) 279, 316, 487, 679
MroXI GAANNNNTTC 1 cut(s) 648
MseI TTAA 2 cut(s) 15, 317
MspR9I CCNGG 1 cut(s) 155
MvaI CCWGG 1 cut(s) 155
MwoI GCNNNNNNNGC 2 cut(s) 389, 500
NdeII GATC 4 cut(s) 212, 225, 361, 472
NlaIII CATG 3 cut(s) 186, 639, 667
NlaIV GGNNCC 2 cut(s) 165, 258
NspI RCATGY 1 cut(s) 667
PdmI GAANNNNTTC 1 cut(s) 648
PfeI GAWTC 2 cut(s) 75, 649
PleI GAGTC 1 cut(s) 147
PpsI GAGTC 1 cut(s) 147
PsiI TTATAA 1 cut(s) 27
Psp1406I AACGTT 1 cut(s) 81
Psp6I CCWGG 1 cut(s) 153
PspGI CCWGG 1 cut(s) 153
PspN4I GGNNCC 2 cut(s) 165, 258
PspPI GGNCC 2 cut(s) 400, 511
PsuI RGATCY 1 cut(s) 212
RsaI GTAC 1 cut(s) 53
RsaNI GTAC 1 cut(s) 52
SaqAI TTAA 2 cut(s) 15, 317
Sau3AI GATC 4 cut(s) 212, 225, 361, 472
Sau96I GGNCC 2 cut(s) 400, 511
SchI GAGTC 1 cut(s) 148
ScrFI CCNGG 1 cut(s) 155
SetI ASST 9 cut(s) 21, 65, 84, 95, 271, 394, 505, 553, 690
SfaNI GCATC 1 cut(s) 664
SinI GGWCC 2 cut(s) 400, 511
Sse9I AATT 1 cut(s) 705
SsiI CCGC 2 cut(s) 615, 667
SspMI CTAG 1 cut(s) 711
StyD4I CCNGG 1 cut(s) 153
StyI CCWWGG 1 cut(s) 710
TaiI ACGT 1 cut(s) 84
TaqI TCGA 1 cut(s) 142
TasI AATT 1 cut(s) 705
TatI WGTACW 1 cut(s) 51
TfiI GAWTC 2 cut(s) 75, 649
Tru1I TTAA 2 cut(s) 15, 317
Tru9I TTAA 2 cut(s) 15, 317
TscAI CASTG 2 cut(s) 402, 604
TspDTI ATGAA 3 cut(s) 161, 420, 495
TspGWI ACGGA 1 cut(s) 238
TspRI CASTG 2 cut(s) 402, 604
VpaK11BI GGWCC 2 cut(s) 400, 511
XceI RCATGY 1 cut(s) 667
XmaJI CCTAGG 1 cut(s) 710
XmnI GAANNNNTTC 1 cut(s) 648
XspI CTAG 1 cut(s) 711
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.