Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013686.1

Orthogroup ID

OG0016449

Physical Location & Seq

Genomic Coordinates Forward (+)

13680 .. 15649

Gene Structure 1970 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013686.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 681 bp

atgattgagttgttgcttaagaatggagctgaaatttttcgagataatgacattggaagaggcattgagacaatggacgccttagttaagcttggttataaagaagttgaaggcgagtttttgtacacttcaagctctgtggggagattcaacgtttgggctaccttttcagtcaaaaatcgtgggattgctatattttatggtggcaagagtcgaatgaatgtccagggcaaggaaccagatgtgtatttcgcatggggcaaggctactttcaagcaggaaggatctgtgttacggatcaaagatggattggagacttccttgctggaaccagcagaacctccatatttgggtagcaaagagatattctactggttttgcaaccagttaaatgaggctattggtttgggttctgtggtggatgatggctttgatccctctgatatagagatggcactcaaagcttcattggaccattttggacagacatctttacagccttctgcaccacctttgcccgaagatgactgcaccatctgttttgatcatagagttgacactgcctttgttccctgtggtcatcttatctgctcaccatgtgcagaaaagattcagcatcagaacatgcggtgtcccttctgccgtgaggtggtgaagaactttgcaattcctaggatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004842 GO:0006464 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0032446 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0061630 GO:0061659 GO:0070647 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Neuralized zf-C3HC4_3

Protein Analysis

226

Amino Acids

25.24

Weight (kDa)

5.08

Isoelectric Point (pI)

31.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016449)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0454391 RchiOBHm_Chr3g0454421 RchiOBHm_Chr3g0454451
rosa_laevigata	RLG00000025454
rosa_multiflora	Rmu_sc0000006.1_g000008 Rmu_sc0007209.1_g000006 Rmu_sc0013686.1_g000005 Rmu_sc0029999.1_g000001
rosa_roxburghii	Rroxscaffold_6G00425060
rosa_rugosa	Rorug02G0654500 Rorug02G0654500
rosa_samantha	Rh3AG059000 Rh3BG061000 Rh3CG059800
rosa_wichuraiana	Rw3G004550

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	99
AciI	CCGC	1 cut(s)	628
AclI	AACGTT	1 cut(s)	153
AclWI	GGATC	3 cut(s)	292, 305, 428
AcsI	RAATTY	1 cut(s)	33
AcyI	GRCGYC	1 cut(s)	78
AdeI	CACNNNGTG	1 cut(s)	599
AfaI	GTAC	1 cut(s)	125
AfiI	CCNNNNNNNGG	3 cut(s)	232, 350, 649
AflII	CTTAAG	1 cut(s)	17
AgsI	TTSAA	4 cut(s)	110, 132, 151, 274
AjnI	CCWGG	1 cut(s)	225
AluBI	AGCT	4 cut(s)	29, 91, 135, 464
AluI	AGCT	4 cut(s)	29, 91, 135, 464
Alw26I	GTCTC	2 cut(s)	62, 308
AlwI	GGATC	3 cut(s)	292, 305, 428
ApoI	RAATTY	1 cut(s)	33
ArsI	GACNNNNNNTTYG	2 cut(s)	548, 580
Asp700I	GAANNNNTTC	2 cut(s)	36, 609
AspA2I	CCTAGG	1 cut(s)	671
AspS9I	GGNCC	1 cut(s)	472
AsuHPI	GGTGA	2 cut(s)	585, 664
AvaII	GGWCC	1 cut(s)	472
AvrII	CCTAGG	1 cut(s)	671
BccI	CCATC	4 cut(s)	299, 419, 445, 542
BceAI	ACGGC	1 cut(s)	627
BciT130I	CCWGG	1 cut(s)	227
BclI	TGATCA	1 cut(s)	544
BcoDI	GTCTC	2 cut(s)	62, 308
BfaI	CTAG	1 cut(s)	672
BfrI	CTTAAG	1 cut(s)	17
BlnI	CCTAGG	1 cut(s)	671
Bme1390I	CCNGG	1 cut(s)	227
Bme18I	GGWCC	1 cut(s)	472
BmgT120I	GGNCC	1 cut(s)	472
BmiI	GGNNCC	2 cut(s)	237, 330
BmrFI	CCNGG	1 cut(s)	227
BmsI	GCATC	1 cut(s)	625
BsaHI	GRCGYC	1 cut(s)	78
BsaJI	CCNNGG	2 cut(s)	226, 671
Bsc4I	CCNNNNNNNGG	3 cut(s)	232, 350, 649
Bse1I	ACTGG	2 cut(s)	377, 385
BseBI	CCWGG	1 cut(s)	227
BseDI	CCNNGG	2 cut(s)	226, 671
BseGI	GGATG	1 cut(s)	427
BseLI	CCNNNNNNNGG	3 cut(s)	232, 350, 649
BseNI	ACTGG	2 cut(s)	377, 385
BsgI	GTGCAG	3 cut(s)	489, 514, 621
BslFI	GGGAC	1 cut(s)	618
BslI	CCNNNNNNNGG	3 cut(s)	232, 350, 649
BsmAI	GTCTC	2 cut(s)	62, 308
BsmFI	GGGAC	1 cut(s)	618
Bsp1407I	TGTACA	1 cut(s)	123
Bsp143I	GATC	4 cut(s)	284, 297, 433, 544
BspACI	CCGC	1 cut(s)	628
BspLI	GGNNCC	2 cut(s)	237, 330
BspPI	GGATC	3 cut(s)	292, 305, 428
BspTI	CTTAAG	1 cut(s)	17
BsrGI	TGTACA	1 cut(s)	123
BsrI	ACTGG	2 cut(s)	377, 385
BssECI	CCNNGG	2 cut(s)	226, 671
BssMI	GATC	4 cut(s)	284, 297, 433, 544
BssNI	GRCGYC	1 cut(s)	78
BssT1I	CCWWGG	1 cut(s)	671
Bst2UI	CCWGG	1 cut(s)	227
Bst6I	CTCTTC	1 cut(s)	52
BstACI	GRCGYC	1 cut(s)	78
BstAFI	CTTAAG	1 cut(s)	17
BstAUI	TGTACA	1 cut(s)	123
BstDEI	CTNAG	1 cut(s)	82
BstF5I	GGATG	1 cut(s)	427
BstKTI	GATC	4 cut(s)	287, 300, 436, 547
BstMAI	GTCTC	2 cut(s)	62, 308
BstMBI	GATC	4 cut(s)	284, 297, 433, 544
BstMWI	GCNNNNNNNGC	1 cut(s)	461
BstNI	CCWGG	1 cut(s)	227
BstNSI	RCATGY	1 cut(s)	628
BstSCI	CCNGG	1 cut(s)	225
BstX2I	RGATCY	1 cut(s)	284
BstYI	RGATCY	1 cut(s)	284
BtsCI	GGATG	1 cut(s)	427
BtsI	GCAGTG	1 cut(s)	558
BtsIMutI	CAGTG	1 cut(s)	558
Cfr13I	GGNCC	1 cut(s)	472
CseI	GACGC	1 cut(s)	86
Csp6I	GTAC	1 cut(s)	124
CspCI	CAANNNNNGTGG	4 cut(s)	120, 155, 163, 198
CviAII	CATG	3 cut(s)	255, 597, 625
CviJI	RGCY	9 cut(s)	29, 91, 135, 161, 266, 398, 429, 464, 499
CviKI_1	RGCY	9 cut(s)	29, 91, 135, 161, 266, 398, 429, 464, 499
CviQI	GTAC	1 cut(s)	124
DdeI	CTNAG	1 cut(s)	82
DpnI	GATC	4 cut(s)	286, 299, 435, 546
DpnII	GATC	4 cut(s)	284, 297, 433, 544
DraIII	CACNNNGTG	1 cut(s)	599
Eam1104I	CTCTTC	1 cut(s)	52
EarI	CTCTTC	1 cut(s)	52
Eco130I	CCWWGG	1 cut(s)	671
Eco47I	GGWCC	1 cut(s)	472
EcoRII	CCWGG	1 cut(s)	225
EcoT14I	CCWWGG	1 cut(s)	671
ErhI	CCWWGG	1 cut(s)	671
FaeI	CATG	3 cut(s)	258, 600, 628
FaiI	YATR	9 cut(s)	99, 194, 201, 256, 346, 446, 549, 598, 626
FaqI	GGGAC	1 cut(s)	618
FatI	CATG	3 cut(s)	254, 596, 624
FbaI	TGATCA	1 cut(s)	544
FokI	GGATG	1 cut(s)	434
FspBI	CTAG	1 cut(s)	672
HgaI	GACGC	1 cut(s)	86
Hin1I	GRCGYC	1 cut(s)	78
Hin1II	CATG	3 cut(s)	258, 600, 628
HincII	GTYRAC	1 cut(s)	556
HindII	GTYRAC	1 cut(s)	556
HindIII	AAGCTT	2 cut(s)	89, 462
HinfI	GANTC	3 cut(s)	147, 211, 610
HphI	GGTGA	2 cut(s)	585, 664
Hpy166II	GTNNAC	2 cut(s)	126, 556
Hpy188I	TCNGA	2 cut(s)	442, 621
Hpy188III	TCNNGA	1 cut(s)	41
Hpy8I	GTNNAC	2 cut(s)	126, 556
HpyAV	CCTTC	4 cut(s)	104, 275, 510, 646
HpyCH4IV	ACGT	1 cut(s)	153
HpyCH4V	TGCA	5 cut(s)	381, 506, 531, 602, 665
HpyF10VI	GCNNNNNNNGC	1 cut(s)	461
HpyF3I	CTNAG	1 cut(s)	82
HpySE526I	ACGT	1 cut(s)	153
Hsp92I	GRCGYC	1 cut(s)	78
Hsp92II	CATG	3 cut(s)	258, 600, 628
Ksp22I	TGATCA	1 cut(s)	544
Kzo9I	GATC	4 cut(s)	284, 297, 433, 544
LmnI	GCTCC	1 cut(s)	26
LpnPI	CCDG	9 cut(s)	212, 239, 252, 263, 311, 345, 358, 398, 586
LweI	GCATC	1 cut(s)	625
MaeI	CTAG	1 cut(s)	672
MaeII	ACGT	1 cut(s)	153
MaeIII	GTNAC	1 cut(s)	291
MalI	GATC	4 cut(s)	286, 299, 435, 546
MboI	GATC	4 cut(s)	284, 297, 433, 544
MboII	GAAGA	3 cut(s)	69, 533, 667
MflI	RGATCY	1 cut(s)	284
MluCI	AATT	2 cut(s)	33, 666
MlyI	GAGTC	1 cut(s)	220
MnlI	CCTC	5 cut(s)	53, 351, 388, 448, 640
MroXI	GAANNNNTTC	2 cut(s)	36, 609
MseI	TTAA	3 cut(s)	18, 87, 389
MspCI	CTTAAG	1 cut(s)	17
MspR9I	CCNGG	1 cut(s)	227
MvaI	CCWGG	1 cut(s)	227
MwoI	GCNNNNNNNGC	1 cut(s)	461
NdeII	GATC	4 cut(s)	284, 297, 433, 544
NlaIII	CATG	3 cut(s)	258, 600, 628
NlaIV	GGNNCC	2 cut(s)	237, 330
NspI	RCATGY	1 cut(s)	628
PdmI	GAANNNNTTC	2 cut(s)	36, 609
PfeI	GAWTC	2 cut(s)	147, 610
PleI	GAGTC	1 cut(s)	219
PpsI	GAGTC	1 cut(s)	219
PsiI	TTATAA	1 cut(s)	99
Psp1406I	AACGTT	1 cut(s)	153
Psp6I	CCWGG	1 cut(s)	225
PspGI	CCWGG	1 cut(s)	225
PspN4I	GGNNCC	2 cut(s)	237, 330
PspPI	GGNCC	1 cut(s)	472
PsuI	RGATCY	1 cut(s)	284
RsaI	GTAC	1 cut(s)	125
RsaNI	GTAC	1 cut(s)	124
SaqAI	TTAA	3 cut(s)	18, 87, 389
Sau3AI	GATC	4 cut(s)	284, 297, 433, 544
Sau96I	GGNCC	1 cut(s)	472
SchI	GAGTC	1 cut(s)	220
ScrFI	CCNGG	1 cut(s)	227
SetI	ASST	9 cut(s)	31, 93, 137, 156, 167, 343, 466, 514, 651
SfaNI	GCATC	1 cut(s)	625
SinI	GGWCC	1 cut(s)	472
SmlI	CTYRAG	1 cut(s)	17
SmoI	CTYRAG	1 cut(s)	17
Sse9I	AATT	2 cut(s)	33, 666
SsiI	CCGC	1 cut(s)	628
SspMI	CTAG	1 cut(s)	672
StyD4I	CCNGG	1 cut(s)	225
StyI	CCWWGG	1 cut(s)	671
TaiI	ACGT	1 cut(s)	156
TaqI	TCGA	2 cut(s)	40, 214
TasI	AATT	2 cut(s)	33, 666
TatI	WGTACW	1 cut(s)	123
TfiI	GAWTC	2 cut(s)	147, 610
Tru1I	TTAA	3 cut(s)	18, 87, 389
Tru9I	TTAA	3 cut(s)	18, 87, 389
TscAI	CASTG	1 cut(s)	565
TspDTI	ATGAA	2 cut(s)	233, 456
TspGWI	ACGGA	1 cut(s)	310
TspRI	CASTG	1 cut(s)	565
Vha464I	CTTAAG	1 cut(s)	17
VpaK11BI	GGWCC	1 cut(s)	472
XapI	RAATTY	1 cut(s)	33
XceI	RCATGY	1 cut(s)	628
XmaJI	CCTAGG	1 cut(s)	671
XmnI	GAANNNNTTC	2 cut(s)	36, 609
XspI	CTAG	1 cut(s)	672

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.