Rmu_sc0029999.1_g000001

ubiquitin-like protein ligase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0029999.1
Physical Location & Seq
Forward (+)
1 .. 805
805 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0029999.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
gctattggtttgggttctgtggtggatgatggctttgatccctctgatatagagatggcactcaaagcttcattggaccattttggacagacatctttacagccttctgcaccacctttgcccgaagatgactgcaccatctgttttgatcatagagttgacactgcctttgttccctgtggtcatcttatctgctcaccatgtgcagaaaagattcagcatcagaacatgcggtgtcccttctgccgtgaggtggtgaagaactttgcaattcctaggatttga

Protein Analysis

94

Amino Acids

10.28

Weight (kDa)

4.88

Isoelectric Point (pI)

39.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 232
AclWI GGATC 1 cut(s) 32
AdeI CACNNNGTG 1 cut(s) 203
AfiI CCNNNNNNNGG 1 cut(s) 253
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
AlwI GGATC 1 cut(s) 32
ArsI GACNNNNNNTTYG 2 cut(s) 152, 184
Asp700I GAANNNNTTC 1 cut(s) 213
AspA2I CCTAGG 1 cut(s) 275
AspS9I GGNCC 1 cut(s) 76
AsuHPI GGTGA 2 cut(s) 189, 268
AvaII GGWCC 1 cut(s) 76
AvrII CCTAGG 1 cut(s) 275
BccI CCATC 3 cut(s) 23, 49, 146
BceAI ACGGC 1 cut(s) 231
BclI TGATCA 1 cut(s) 148
BfaI CTAG 1 cut(s) 276
BlnI CCTAGG 1 cut(s) 275
Bme18I GGWCC 1 cut(s) 76
BmgT120I GGNCC 1 cut(s) 76
BmsI GCATC 1 cut(s) 229
BsaJI CCNNGG 1 cut(s) 275
Bsc4I CCNNNNNNNGG 1 cut(s) 253
BseDI CCNNGG 1 cut(s) 275
BseGI GGATG 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 253
BsgI GTGCAG 3 cut(s) 93, 118, 225
BslFI GGGAC 1 cut(s) 222
BslI CCNNNNNNNGG 1 cut(s) 253
BsmFI GGGAC 1 cut(s) 222
Bsp143I GATC 2 cut(s) 37, 148
BspACI CCGC 1 cut(s) 232
BspPI GGATC 1 cut(s) 32
BssECI CCNNGG 1 cut(s) 275
BssMI GATC 2 cut(s) 37, 148
BssT1I CCWWGG 1 cut(s) 275
BstF5I GGATG 1 cut(s) 31
BstKTI GATC 2 cut(s) 40, 151
BstMBI GATC 2 cut(s) 37, 148
BstMWI GCNNNNNNNGC 1 cut(s) 65
BstNSI RCATGY 1 cut(s) 232
BtsCI GGATG 1 cut(s) 31
BtsI GCAGTG 1 cut(s) 162
BtsIMutI CAGTG 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 76
CviAII CATG 2 cut(s) 201, 229
CviJI RGCY 3 cut(s) 33, 68, 103
CviKI_1 RGCY 3 cut(s) 33, 68, 103
DpnI GATC 2 cut(s) 39, 150
DpnII GATC 2 cut(s) 37, 148
DraIII CACNNNGTG 1 cut(s) 203
Eco130I CCWWGG 1 cut(s) 275
Eco47I GGWCC 1 cut(s) 76
EcoT14I CCWWGG 1 cut(s) 275
ErhI CCWWGG 1 cut(s) 275
FaeI CATG 2 cut(s) 204, 232
FaiI YATR 4 cut(s) 50, 153, 202, 230
FaqI GGGAC 1 cut(s) 222
FatI CATG 2 cut(s) 200, 228
FbaI TGATCA 1 cut(s) 148
FokI GGATG 1 cut(s) 38
FspBI CTAG 1 cut(s) 276
Hin1II CATG 2 cut(s) 204, 232
HincII GTYRAC 1 cut(s) 160
HindII GTYRAC 1 cut(s) 160
HindIII AAGCTT 1 cut(s) 66
HinfI GANTC 1 cut(s) 214
HphI GGTGA 2 cut(s) 189, 268
Hpy166II GTNNAC 1 cut(s) 160
Hpy188I TCNGA 2 cut(s) 46, 225
Hpy8I GTNNAC 1 cut(s) 160
HpyAV CCTTC 2 cut(s) 114, 250
HpyCH4V TGCA 4 cut(s) 110, 135, 206, 269
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
Hsp92II CATG 2 cut(s) 204, 232
Ksp22I TGATCA 1 cut(s) 148
Kzo9I GATC 2 cut(s) 37, 148
LpnPI CCDG 1 cut(s) 190
LweI GCATC 1 cut(s) 229
MaeI CTAG 1 cut(s) 276
MalI GATC 2 cut(s) 39, 150
MboI GATC 2 cut(s) 37, 148
MboII GAAGA 2 cut(s) 137, 271
MluCI AATT 1 cut(s) 270
MnlI CCTC 2 cut(s) 52, 244
MroXI GAANNNNTTC 1 cut(s) 213
MwoI GCNNNNNNNGC 1 cut(s) 65
NdeII GATC 2 cut(s) 37, 148
NlaIII CATG 2 cut(s) 204, 232
NspI RCATGY 1 cut(s) 232
PdmI GAANNNNTTC 1 cut(s) 213
PfeI GAWTC 1 cut(s) 214
PspPI GGNCC 1 cut(s) 76
Sau3AI GATC 2 cut(s) 37, 148
Sau96I GGNCC 1 cut(s) 76
SetI ASST 3 cut(s) 70, 118, 255
SfaNI GCATC 1 cut(s) 229
SgeI CNNG 5 cut(s) 134, 189, 213, 241, 260
SinI GGWCC 1 cut(s) 76
Sse9I AATT 1 cut(s) 270
SsiI CCGC 1 cut(s) 232
SspMI CTAG 1 cut(s) 276
StyI CCWWGG 1 cut(s) 275
TasI AATT 1 cut(s) 270
TfiI GAWTC 1 cut(s) 214
TscAI CASTG 1 cut(s) 169
TspDTI ATGAA 1 cut(s) 60
TspRI CASTG 1 cut(s) 169
VpaK11BI GGWCC 1 cut(s) 76
XceI RCATGY 1 cut(s) 232
XmaJI CCTAGG 1 cut(s) 275
XmnI GAANNNNTTC 1 cut(s) 213
XspI CTAG 1 cut(s) 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.