Rmu_sc0007223.1_g000004
MYB Family

Myb family transcription factor APL-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007223.1
Physical Location & Seq
Forward (+)
32621 .. 34435
1815 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007223.1_g000004.1.cds

Sequence Viewer

Length: 1083 bp
atgaattctcatgagagccacagacccatgtgcgtccaaggcgactctggccttgtcctcaccactgaccctaagcctcgtctccggtggactgtcgagcttcatgaacgattcgtggatgctgtgactcaactcggaggaccagacaaggctacacctaagactatcatgagggttatgggtgtgaagggtctcacactttaccacctcaagagccacctccagaaatttaggctaggaaagcaacctcacaaggaattcaatgatcactcgattaaagatcatgcatcttcacttgatctccaaagaaatagtgcatcttcatctgggataataggccgcagtatgaacgagatgcaaatggaggtgcagagaagactgcatgaacaattggaggtccaaaaacatcttcagttgagaatcgaagctcaaggaaagtacatgcaaagcatactagagaaagcctgccaaacccttgctggtgaaaacaacatggcagctgcagctggaagctacaagggtaatattggaaataaccaaggtgttaatcatgctgacatgggaaacctaaaggatttcaattctcctctcaactttccatcatttcaagacctgaacatatatggatctggcgatcaccttgatcaacttcaacagaacagcttggacaggccacctcttgatcatcacagttttatgccaaacaatgataacattaattgcatgggatcaaagaagaggccaagtccgtataacagtggtaacagtagtggcaagagcccgttgatttggtctgatgatttaagacttcaagacttgggaactgccgcatcatgtcttggacctcaggatgatcatcagattcagattgcaccaccatccattgaaagaggcactgatcagatcgagtcgatttcagatatttatgaatcgaagccgatgattcaaggggacgagaagaagtttgaagcgggaaataagctcgagaggccttcaccacgtagagcaccaatgggatcagaaaggatgaaccccatgatcaacgctggtgtgagacaaggaagaaattcgccatttgggtga

Protein Analysis

360

Amino Acids

40.09

Weight (kDa)

7.78

Isoelectric Point (pI)

53.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010410)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 340, 828, 971
AclWI GGATC 3 cut(s) 634, 736, 1024
AcsI RAATTY 4 cut(s) 4, 227, 257, 1066
AcuI CTGAAG 1 cut(s) 395
AfaI GTAC 1 cut(s) 440
AgsI TTSAA 8 cut(s) 262, 580, 608, 653, 812, 887, 947, 968
AjuI GAANNNNNNNTTGG 2 cut(s) 393, 425
AluBI AGCT 7 cut(s) 100, 428, 500, 506, 513, 663, 982
AluI AGCT 7 cut(s) 100, 428, 500, 506, 513, 663, 982
Alw21I GWGCWC 1 cut(s) 1009
Alw26I GTCTC 3 cut(s) 86, 197, 1048
AlwI GGATC 3 cut(s) 634, 736, 1024
Ama87I CYCGRG 1 cut(s) 983
AoxI GGCC 5 cut(s) 49, 337, 671, 740, 989
ApeKI GCWGC 3 cut(s) 497, 500, 503
ApoI RAATTY 4 cut(s) 4, 227, 257, 1066
AseI ATTAAT 1 cut(s) 717
Asp700I GAANNNNTTC 1 cut(s) 1066
AspS9I GGNCC 3 cut(s) 140, 397, 842
AsuHPI GGTGA 4 cut(s) 52, 494, 629, 987
AvaI CYCGRG 1 cut(s) 983
AvaII GGWCC 3 cut(s) 140, 397, 842
AxyI CCTNAGG 1 cut(s) 846
BanII GRGCYC 1 cut(s) 782
BbsI GAAGAC 1 cut(s) 382
Bbv12I GWGCWC 1 cut(s) 1009
BbvI GCAGC 3 cut(s) 487, 509, 515
BccI CCATC 2 cut(s) 607, 886
BclI TGATCA 6 cut(s) 265, 643, 682, 853, 898, 1038
BcoDI GTCTC 3 cut(s) 86, 197, 1048
BfaI CTAG 2 cut(s) 236, 455
BfmI CTRYAG 1 cut(s) 501
BisI GCNGC 5 cut(s) 340, 498, 501, 504, 828
BlsI GCNGC 5 cut(s) 341, 499, 502, 505, 829
Bme18I GGWCC 3 cut(s) 140, 397, 842
BmeT110I CYCGRG 1 cut(s) 983
BmgT120I GGNCC 3 cut(s) 140, 397, 842
BmsI GCATC 5 cut(s) 109, 296, 326, 345, 839
BpiI GAAGAC 1 cut(s) 382
BpmI CTGGAG 1 cut(s) 206
Bpu10I CCTNAGC 1 cut(s) 72
BpuEI CTTGAG 2 cut(s) 194, 414
BsaAI YACGTR 1 cut(s) 1001
BsaBI GATNNNNATC 1 cut(s) 855
BsaI GGTCTC 1 cut(s) 197
BsaJI CCNNGG 2 cut(s) 37, 538
BsaWI WCCGGW 1 cut(s) 84
BsaXI ACNNNNNCTCC 2 cut(s) 285, 315
Bse21I CCTNAGG 1 cut(s) 846
Bse8I GATNNNNATC 1 cut(s) 855
BseDI CCNNGG 2 cut(s) 37, 538
BseGI GGATG 4 cut(s) 124, 856, 878, 1032
BseJI GATNNNNATC 1 cut(s) 855
BseMII CTCAG 1 cut(s) 860
BseRI GAGGAG 1 cut(s) 576
BseXI GCAGC 3 cut(s) 487, 509, 515
BsgI GTGCAG 1 cut(s) 389
BshFI GGCC 5 cut(s) 51, 339, 673, 742, 991
BsiHKAI GWGCWC 1 cut(s) 1009
BsiHKCI CYCGRG 1 cut(s) 983
BsiSI CCGG 1 cut(s) 85
BslFI GGGAC 1 cut(s) 965
BsmAI GTCTC 3 cut(s) 86, 197, 1048
BsmBI CGTCTC 1 cut(s) 86
BsmFI GGGAC 1 cut(s) 965
BsnI GGCC 5 cut(s) 51, 339, 673, 742, 991
Bso31I GGTCTC 1 cut(s) 197
BsoBI CYCGRG 1 cut(s) 983
Bsp1286I GDGCHC 2 cut(s) 782, 1009
BspACI CCGC 3 cut(s) 340, 828, 971
BspANI GGCC 5 cut(s) 51, 339, 673, 742, 991
BspCNI CTCAG 1 cut(s) 859
BspHI TCATGA 3 cut(s) 10, 103, 168
BspMAI CTGCAG 1 cut(s) 505
BspPI GGATC 3 cut(s) 634, 736, 1024
BspTNI GGTCTC 1 cut(s) 197
BssECI CCNNGG 2 cut(s) 37, 538
BssT1I CCWWGG 2 cut(s) 37, 538
Bst4CI ACNGT 4 cut(s) 94, 692, 758, 767
Bst6I CTCTTC 1 cut(s) 731
BstBAI YACGTR 1 cut(s) 1001
BstC8I GCNNGC 1 cut(s) 466
BstDEI CTNAG 3 cut(s) 72, 159, 846
BstF5I GGATG 4 cut(s) 124, 856, 878, 1032
BstMAI GTCTC 3 cut(s) 86, 197, 1048
BstMWI GCNNNNNNNGC 5 cut(s) 39, 48, 241, 503, 988
BstNSI RCATGY 1 cut(s) 445
BstSFI CTRYAG 1 cut(s) 501
BstV1I GCAGC 3 cut(s) 487, 509, 515
BstV2I GAAGAC 1 cut(s) 382
BstX2I RGATCY 1 cut(s) 626
BstYI RGATCY 1 cut(s) 626
Bsu36I CCTNAGG 1 cut(s) 846
BsuRI GGCC 5 cut(s) 51, 339, 673, 742, 991
BtsCI GGATG 4 cut(s) 124, 856, 878, 1032
BtsIMutI CAGTG 3 cut(s) 63, 763, 894
Cac8I GCNNGC 1 cut(s) 466
CciI TCATGA 3 cut(s) 10, 103, 168
Cfr13I GGNCC 3 cut(s) 140, 397, 842
CseI GACGC 1 cut(s) 22
Csp6I GTAC 1 cut(s) 439
CviQI GTAC 1 cut(s) 439
DdeI CTNAG 3 cut(s) 72, 159, 846
Eam1104I CTCTTC 1 cut(s) 731
EarI CTCTTC 1 cut(s) 731
Eco130I CCWWGG 2 cut(s) 37, 538
Eco147I AGGCCT 1 cut(s) 991
Eco24I GRGCYC 1 cut(s) 782
Eco31I GGTCTC 1 cut(s) 197
Eco47I GGWCC 3 cut(s) 140, 397, 842
Eco57I CTGAAG 1 cut(s) 395
Eco81I CCTNAGG 1 cut(s) 846
Eco88I CYCGRG 1 cut(s) 983
EcoRI GAATTC 2 cut(s) 4, 257
EcoT14I CCWWGG 2 cut(s) 37, 538
EcoT22I ATGCAT 1 cut(s) 289
EcoT38I GRGCYC 1 cut(s) 782
ErhI CCWWGG 2 cut(s) 37, 538
Esp3I CGTCTC 1 cut(s) 86
FaqI GGGAC 1 cut(s) 965
FauI CCCGC 1 cut(s) 964
FbaI TGATCA 6 cut(s) 265, 643, 682, 853, 898, 1038
Fnu4HI GCNGC 5 cut(s) 340, 498, 501, 504, 828
FokI GGATG 4 cut(s) 131, 863, 865, 1039
FriOI GRGCYC 1 cut(s) 782
Fsp4HI GCNGC 5 cut(s) 340, 498, 501, 504, 828
FspBI CTAG 2 cut(s) 236, 455
GluI GCNGC 5 cut(s) 340, 498, 501, 504, 828
GsuI CTGGAG 1 cut(s) 206
HaeIII GGCC 5 cut(s) 51, 339, 673, 742, 991
HapII CCGG 1 cut(s) 85
HgaI GACGC 1 cut(s) 22
HinfI GANTC 8 cut(s) 44, 111, 127, 420, 862, 908, 929, 943
HpaII CCGG 1 cut(s) 85
HphI GGTGA 4 cut(s) 52, 494, 629, 987
Hpy166II GTNNAC 1 cut(s) 90
Hpy188I TCNGA 7 cut(s) 137, 796, 861, 867, 903, 919, 1021
Hpy8I GTNNAC 1 cut(s) 90
HpyAV CCTTC 2 cut(s) 181, 1002
HpyCH4III ACNGT 4 cut(s) 94, 692, 758, 767
HpyCH4IV ACGT 1 cut(s) 1000
HpyCH4V TGCA 9 cut(s) 287, 317, 358, 370, 382, 445, 503, 723, 872
HpyF10VI GCNNNNNNNGC 5 cut(s) 39, 48, 241, 503, 988
HpyF3I CTNAG 3 cut(s) 72, 159, 846
HpySE526I ACGT 1 cut(s) 1000
Ksp22I TGATCA 6 cut(s) 265, 643, 682, 853, 898, 1038
Lsp1109I GCAGC 3 cut(s) 487, 509, 515
LweI GCATC 5 cut(s) 109, 296, 326, 345, 839
MaeI CTAG 2 cut(s) 236, 455
MaeII ACGT 1 cut(s) 1000
MaeIII GTNAC 2 cut(s) 124, 761
MboII GAAGA 7 cut(s) 282, 312, 387, 401, 748, 970, 1074
MfeI CAATTG 1 cut(s) 389
MflI RGATCY 1 cut(s) 626
MhlI GDGCHC 2 cut(s) 782, 1009
MluCI AATT 7 cut(s) 4, 227, 257, 389, 580, 718, 1066
MlyI GAGTC 3 cut(s) 38, 121, 917
Mph1103I ATGCAT 1 cut(s) 289
MroXI GAANNNNTTC 1 cut(s) 1066
MseI TTAA 4 cut(s) 276, 546, 717, 803
MslI CAYNNNNRTG 1 cut(s) 1078
MspA1I CMGCKG 2 cut(s) 500, 506
MspI CCGG 1 cut(s) 85
MunI CAATTG 1 cut(s) 389
MwoI GCNNNNNNNGC 5 cut(s) 39, 48, 241, 503, 988
NmuCI GTSAC 1 cut(s) 124
NsiI ATGCAT 1 cut(s) 289
NspI RCATGY 1 cut(s) 445
PaeR7I CTCGAG 1 cut(s) 983
PagI TCATGA 3 cut(s) 10, 103, 168
PceI AGGCCT 1 cut(s) 991
PdmI GAANNNNTTC 1 cut(s) 1066
PfeI GAWTC 5 cut(s) 111, 420, 862, 929, 943
PkrI GCNGC 5 cut(s) 341, 499, 502, 505, 829
PleI GAGTC 3 cut(s) 38, 121, 916
PpsI GAGTC 3 cut(s) 38, 121, 916
Ppu21I YACGTR 1 cut(s) 1001
PshBI ATTAAT 1 cut(s) 717
PspPI GGNCC 3 cut(s) 140, 397, 842
PstI CTGCAG 1 cut(s) 505
PsuI RGATCY 1 cut(s) 626
PvuII CAGCTG 2 cut(s) 500, 506
RsaI GTAC 1 cut(s) 440
RsaNI GTAC 1 cut(s) 439
RseI CAYNNNNRTG 1 cut(s) 1078
SaqAI TTAA 4 cut(s) 276, 546, 717, 803
SatI GCNGC 5 cut(s) 340, 498, 501, 504, 828
Sau96I GGNCC 3 cut(s) 140, 397, 842
SchI GAGTC 3 cut(s) 38, 121, 917
SduI GDGCHC 2 cut(s) 782, 1009
SfaNI GCATC 5 cut(s) 109, 296, 326, 345, 839
SfcI CTRYAG 1 cut(s) 501
Sfr274I CTCGAG 1 cut(s) 983
SinI GGWCC 3 cut(s) 140, 397, 842
SlaI CTCGAG 1 cut(s) 983
SmiMI CAYNNNNRTG 1 cut(s) 1078
SmlI CTYRAG 3 cut(s) 209, 429, 983
SmoI CTYRAG 3 cut(s) 209, 429, 983
Sse9I AATT 7 cut(s) 4, 227, 257, 389, 580, 718, 1066
SseBI AGGCCT 1 cut(s) 991
SsiI CCGC 3 cut(s) 340, 828, 971
SspI AATATT 1 cut(s) 526
SspMI CTAG 2 cut(s) 236, 455
StuI AGGCCT 1 cut(s) 991
StyI CCWWGG 2 cut(s) 37, 538
TaaI ACNGT 4 cut(s) 94, 692, 758, 767
TaiI ACGT 1 cut(s) 1003
TaqI TCGA 7 cut(s) 96, 272, 423, 906, 911, 932, 984
TasI AATT 7 cut(s) 4, 227, 257, 389, 580, 718, 1066
TatI WGTACW 1 cut(s) 438
TauI GCSGC 2 cut(s) 342, 830
TfiI GAWTC 5 cut(s) 111, 420, 862, 929, 943
Tru1I TTAA 4 cut(s) 276, 546, 717, 803
Tru9I TTAA 4 cut(s) 276, 546, 717, 803
TscAI CASTG 3 cut(s) 70, 763, 901
TseFI GTSAC 1 cut(s) 124
TseI GCWGC 3 cut(s) 497, 500, 503
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 8 cut(s) 17, 92, 120, 312, 362, 399, 942, 1043
TspGWI ACGGA 1 cut(s) 738
TspRI CASTG 3 cut(s) 70, 763, 901
VpaK11BI GGWCC 3 cut(s) 140, 397, 842
VspI ATTAAT 1 cut(s) 717
XapI RAATTY 4 cut(s) 4, 227, 257, 1066
XceI RCATGY 1 cut(s) 445
XcmI CCANNNNNNNNNTGG 2 cut(s) 44, 476
XhoI CTCGAG 1 cut(s) 983
XmnI GAANNNNTTC 1 cut(s) 1066
XspI CTAG 2 cut(s) 236, 455
Zsp2I ATGCAT 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.