Rmu_sc0007472.1_g000005

Isocitrate dehydrogenase NADP

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007472.1
Physical Location & Seq
Reverse (-)
12676 .. 15119
2444 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007472.1_g000005.1.cds

Sequence Viewer

Length: 1065 bp
atgtatagaaagttagataaaagattggatcatcatctggagggttggcagagcaaatttctctctaaagctgggaagctgatattagtgaaagcagtggctcaggcaatcccaacttatacgatgagtgtttttaaattgccaaaaggggtacagcgaaggtttcaatctaagataactaggttctggtggggtaagggtggtgataagaaagggatgcattggtgcaagtgggagaaattgtgtggcagtaaatgggatggtggtttgggatttagagatttggagattttcaataaagctctgctagccaaaacgttttggcagctaatgctttctctgcattctctcgacagcaggttaactagagttaagtactttccagatgcagattggttggatgcctggtactgttttcagagaactgattctttgcaagaacattccttgcctcattggacgaagccagtatgcattggaaaacatgctttcggtgatctatatcgagcaactgatacagttataaaaggacctgggaaattgaaattgttgtttgttccagaaggaaaggacgagatgaccgaactggaattacacaactttacaattgccatgtacaacaccgatgggtcaatctgtgcttttgtagaagctcctatgaacacagcttatgagaaaaaggtggccacttataatagcacaaaaaacactattcttaatgagtatgatggaaggttcaaggacatatttcaagaagtttatgaagcccattggaaatcgaagtatgaagctgctggcatatggtatgaacatcacctcattgatgatatggtggcttacgcattcaaaagtgaaggtggttatgtttgggcatccaagaattatgatggcgatgtgcaaagtgatttcttagctcaagaagctggaagaagcttgtattctgggaaaatgaccaaggatcttgcactagttcttaacggacctaaccttgctaggaaccactacttgaacacggaagagttcattgatgccgtggcagcagaactgaacgcaaagctttcttga

Protein Analysis

354

Amino Acids

40.79

Weight (kDa)

8.69

Isoelectric Point (pI)

26.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018047)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 524, 693
Acc36I ACCTGC 1 cut(s) 348
AclI AACGTT 1 cut(s) 317
AclWI GGATC 2 cut(s) 36, 966
AcoI YGGCCR 1 cut(s) 684
AcsI RAATTY 1 cut(s) 56
AfaI GTAC 4 cut(s) 153, 377, 410, 617
AgsI TTSAA 7 cut(s) 167, 295, 544, 739, 752, 847, 1009
AhlI ACTAGT 1 cut(s) 967
AjnI CCWGG 2 cut(s) 404, 532
AlwI GGATC 2 cut(s) 36, 966
AoxI GGCC 1 cut(s) 684
ApeKI GCWGC 3 cut(s) 325, 791, 1037
ApoI RAATTY 1 cut(s) 56
Asp700I GAANNNNTTC 1 cut(s) 427
AspS9I GGNCC 2 cut(s) 530, 980
AsuHPI GGTGA 3 cut(s) 215, 506, 806
AsuNHI GCTAGC 1 cut(s) 307
AvaII GGWCC 2 cut(s) 530, 980
BalI TGGCCA 1 cut(s) 686
BbvI GCAGC 3 cut(s) 337, 778, 1049
BccI CCATC 4 cut(s) 254, 620, 722, 881
BceAI ACGGC 1 cut(s) 1016
BciT130I CCWGG 2 cut(s) 406, 534
BcuI ACTAGT 1 cut(s) 967
BfaI CTAG 5 cut(s) 180, 308, 366, 968, 993
BfuAI ACCTGC 1 cut(s) 348
BisI GCNGC 3 cut(s) 326, 792, 1038
BlsI GCNGC 3 cut(s) 327, 793, 1039
BmcAI AGTACT 1 cut(s) 377
Bme1390I CCNGG 2 cut(s) 406, 534
Bme18I GGWCC 2 cut(s) 530, 980
BmgT120I GGNCC 2 cut(s) 530, 980
BmiI GGNNCC 1 cut(s) 998
BmrFI CCNGG 2 cut(s) 406, 534
BmsI GCATC 5 cut(s) 207, 376, 391, 881, 1018
BmtI GCTAGC 1 cut(s) 311
BpmI CTGGAG 1 cut(s) 59
Bpu10I CCTNAGC 1 cut(s) 102
BpuEI CTTGAG 1 cut(s) 900
BsaBI GATNNNNATC 2 cut(s) 33, 501
BsaJI CCNNGG 3 cut(s) 533, 954, 1032
BsaXI ACNNNNNCTCC 2 cut(s) 227, 257
Bse1I ACTGG 2 cut(s) 467, 591
Bse8I GATNNNNATC 2 cut(s) 33, 501
BseBI CCWGG 2 cut(s) 406, 534
BseDI CCNNGG 3 cut(s) 533, 954, 1032
BseGI GGATG 4 cut(s) 222, 265, 406, 872
BseJI GATNNNNATC 2 cut(s) 33, 501
BseMII CTCAG 1 cut(s) 116
BseNI ACTGG 2 cut(s) 467, 591
BseXI GCAGC 3 cut(s) 337, 778, 1049
BseYI CCCAGC 1 cut(s) 71
BshFI GGCC 1 cut(s) 686
BsmI GAATGC 2 cut(s) 343, 842
BsnI GGCC 1 cut(s) 686
Bsp1407I TGTACA 1 cut(s) 615
Bsp143I GATC 3 cut(s) 28, 496, 958
BspANI GGCC 1 cut(s) 686
BspCNI CTCAG 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 998
BspMI ACCTGC 1 cut(s) 348
BspOI GCTAGC 1 cut(s) 311
BspPI GGATC 2 cut(s) 36, 966
BsrGI TGTACA 1 cut(s) 615
BsrI ACTGG 2 cut(s) 467, 591
BssECI CCNNGG 3 cut(s) 533, 954, 1032
BssMI GATC 3 cut(s) 28, 496, 958
BssT1I CCWWGG 1 cut(s) 954
Bst2UI CCWGG 2 cut(s) 406, 534
Bst4CI ACNGT 2 cut(s) 413, 520
Bst6I CTCTTC 1 cut(s) 1011
BstAPI GCANNNNNTGC 1 cut(s) 331
BstAUI TGTACA 1 cut(s) 615
BstC8I GCNNGC 2 cut(s) 309, 796
BstDEI CTNAG 3 cut(s) 102, 171, 910
BstDSI CCRYGG 1 cut(s) 1032
BstF5I GGATG 4 cut(s) 222, 265, 406, 872
BstKTI GATC 3 cut(s) 31, 499, 961
BstMBI GATC 3 cut(s) 28, 496, 958
BstMWI GCNNNNNNNGC 5 cut(s) 308, 331, 340, 920, 1037
BstNI CCWGG 2 cut(s) 406, 534
BstNSI RCATGY 1 cut(s) 488
BstSCI CCNGG 2 cut(s) 404, 532
BstV1I GCAGC 3 cut(s) 337, 778, 1049
BstX2I RGATCY 1 cut(s) 958
BstYI RGATCY 1 cut(s) 958
BsuRI GGCC 1 cut(s) 686
BtgI CCRYGG 1 cut(s) 1032
BtgZI GCGATG 1 cut(s) 906
BtsCI GGATG 4 cut(s) 222, 265, 406, 872
BtsI GCAGTG 1 cut(s) 102
BtsIMutI CAGTG 1 cut(s) 102
BveI ACCTGC 1 cut(s) 348
Cac8I GCNNGC 2 cut(s) 309, 796
Cfr13I GGNCC 2 cut(s) 530, 980
Csp6I GTAC 4 cut(s) 152, 376, 409, 616
CviAII CATG 2 cut(s) 485, 613
CviQI GTAC 4 cut(s) 152, 376, 409, 616
DdeI CTNAG 3 cut(s) 102, 171, 910
DpnI GATC 3 cut(s) 30, 498, 960
DpnII GATC 3 cut(s) 28, 496, 958
DraI TTTAAA 1 cut(s) 136
EaeI YGGCCR 1 cut(s) 684
Eam1104I CTCTTC 1 cut(s) 1011
EarI CTCTTC 1 cut(s) 1011
Eco130I CCWWGG 1 cut(s) 954
Eco47I GGWCC 2 cut(s) 530, 980
EcoO109I RGGNCCY 1 cut(s) 530
EcoRII CCWGG 2 cut(s) 404, 532
EcoT14I CCWWGG 1 cut(s) 954
EcoT22I ATGCAT 2 cut(s) 222, 476
ErhI CCWWGG 1 cut(s) 954
FaeI CATG 2 cut(s) 488, 616
FatI CATG 2 cut(s) 484, 612
FauNDI CATATG 1 cut(s) 800
Fnu4HI GCNGC 3 cut(s) 326, 792, 1038
FokI GGATG 4 cut(s) 229, 272, 413, 859
Fsp4HI GCNGC 3 cut(s) 326, 792, 1038
FspBI CTAG 5 cut(s) 180, 308, 366, 968, 993
GluI GCNGC 3 cut(s) 326, 792, 1038
GsaI CCCAGC 1 cut(s) 75
GsuI CTGGAG 1 cut(s) 59
HaeIII GGCC 1 cut(s) 686
Hin1II CATG 2 cut(s) 488, 616
HincII GTYRAC 1 cut(s) 363
HindII GTYRAC 1 cut(s) 363
HindIII AAGCTT 2 cut(s) 931, 1055
HinfI GANTC 1 cut(s) 428
HpaI GTTAAC 1 cut(s) 363
HphI GGTGA 3 cut(s) 215, 506, 806
Hpy166II GTNNAC 1 cut(s) 363
Hpy188I TCNGA 1 cut(s) 420
Hpy188III TCNNGA 7 cut(s) 38, 350, 383, 560, 752, 917, 1062
Hpy8I GTNNAC 1 cut(s) 363
HpyAV CCTTC 4 cut(s) 153, 557, 726, 848
HpyCH4III ACNGT 2 cut(s) 413, 520
HpyCH4IV ACGT 1 cut(s) 317
HpyCH4V TGCA 8 cut(s) 220, 228, 343, 389, 436, 474, 898, 965
HpyF10VI GCNNNNNNNGC 5 cut(s) 308, 331, 340, 920, 1037
HpyF3I CTNAG 3 cut(s) 102, 171, 910
HpySE526I ACGT 1 cut(s) 317
Hsp92II CATG 2 cut(s) 488, 616
KspAI GTTAAC 1 cut(s) 363
Kzo9I GATC 3 cut(s) 28, 496, 958
LmnI GCTCC 1 cut(s) 658
Lsp1109I GCAGC 3 cut(s) 337, 778, 1049
LweI GCATC 5 cut(s) 207, 376, 391, 881, 1018
MaeI CTAG 5 cut(s) 180, 308, 366, 968, 993
MaeII ACGT 1 cut(s) 317
MalI GATC 3 cut(s) 30, 498, 960
MboI GATC 3 cut(s) 28, 496, 958
MboII GAAGA 2 cut(s) 939, 1028
MfeI CAATTG 1 cut(s) 606
MflI RGATCY 1 cut(s) 958
MlsI TGGCCA 1 cut(s) 686
MluCI AATT 8 cut(s) 56, 137, 239, 539, 545, 590, 606, 880
MluNI TGGCCA 1 cut(s) 686
MmeI TCCRAC 1 cut(s) 378
MnlI CCTC 3 cut(s) 34, 462, 827
Mox20I TGGCCA 1 cut(s) 686
Mph1103I ATGCAT 2 cut(s) 222, 476
MroXI GAANNNNTTC 1 cut(s) 427
MscI TGGCCA 1 cut(s) 686
MseI TTAA 5 cut(s) 135, 362, 372, 717, 975
Msp20I TGGCCA 1 cut(s) 686
MspR9I CCNGG 2 cut(s) 406, 534
MunI CAATTG 1 cut(s) 606
Mva1269I GAATGC 2 cut(s) 343, 842
MvaI CCWGG 2 cut(s) 406, 534
MwoI GCNNNNNNNGC 5 cut(s) 308, 331, 340, 920, 1037
NdeI CATATG 1 cut(s) 800
NdeII GATC 3 cut(s) 28, 496, 958
NheI GCTAGC 1 cut(s) 307
NlaIII CATG 2 cut(s) 488, 616
NlaIV GGNNCC 1 cut(s) 998
NsiI ATGCAT 2 cut(s) 222, 476
NspI RCATGY 1 cut(s) 488
PcsI WCGNNNNNNNCGW 1 cut(s) 579
PctI GAATGC 2 cut(s) 343, 842
PdmI GAANNNNTTC 1 cut(s) 427
PfeI GAWTC 1 cut(s) 428
PkrI GCNGC 3 cut(s) 327, 793, 1039
PpuMI RGGWCCY 1 cut(s) 530
PsiI TTATAA 2 cut(s) 524, 693
Psp1406I AACGTT 1 cut(s) 317
Psp5II RGGWCCY 1 cut(s) 530
Psp6I CCWGG 2 cut(s) 404, 532
PspFI CCCAGC 1 cut(s) 71
PspGI CCWGG 2 cut(s) 404, 532
PspN4I GGNNCC 1 cut(s) 998
PspPI GGNCC 2 cut(s) 530, 980
PspPPI RGGWCCY 1 cut(s) 530
PsrI GAACNNNNNNTAC 2 cut(s) 576, 608
PsuI RGATCY 1 cut(s) 958
RsaI GTAC 4 cut(s) 153, 377, 410, 617
RsaNI GTAC 4 cut(s) 152, 376, 409, 616
SaqAI TTAA 5 cut(s) 135, 362, 372, 717, 975
SatI GCNGC 3 cut(s) 326, 792, 1038
Sau3AI GATC 3 cut(s) 28, 496, 958
Sau96I GGNCC 2 cut(s) 530, 980
ScaI AGTACT 1 cut(s) 377
ScrFI CCNGG 2 cut(s) 406, 534
SfaNI GCATC 5 cut(s) 207, 376, 391, 881, 1018
SinI GGWCC 2 cut(s) 530, 980
SmlI CTYRAG 1 cut(s) 915
SmoI CTYRAG 1 cut(s) 915
SpeI ACTAGT 1 cut(s) 967
Sse9I AATT 8 cut(s) 56, 137, 239, 539, 545, 590, 606, 880
SspMI CTAG 5 cut(s) 180, 308, 366, 968, 993
StyD4I CCNGG 2 cut(s) 404, 532
StyI CCWWGG 1 cut(s) 954
TaaI ACNGT 2 cut(s) 413, 520
TaiI ACGT 1 cut(s) 320
TaqI TCGA 3 cut(s) 351, 505, 779
TaqII GACCGA 1 cut(s) 596
TasI AATT 8 cut(s) 56, 137, 239, 539, 545, 590, 606, 880
TatI WGTACW 2 cut(s) 375, 615
TfiI GAWTC 1 cut(s) 428
Tru1I TTAA 5 cut(s) 135, 362, 372, 717, 975
Tru9I TTAA 5 cut(s) 135, 362, 372, 717, 975
TscAI CASTG 1 cut(s) 102
TseI GCWGC 3 cut(s) 325, 791, 1037
TspDTI ATGAA 5 cut(s) 674, 777, 801, 822, 1012
TspGWI ACGGA 2 cut(s) 993, 1028
TspRI CASTG 1 cut(s) 102
VpaK11BI GGWCC 2 cut(s) 530, 980
XapI RAATTY 1 cut(s) 56
XceI RCATGY 1 cut(s) 488
XcmI CCANNNNNNNNNTGG 1 cut(s) 390
XmnI GAANNNNTTC 1 cut(s) 427
XspI CTAG 5 cut(s) 180, 308, 366, 968, 993
ZrmI AGTACT 1 cut(s) 377
Zsp2I ATGCAT 2 cut(s) 222, 476
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.