Rmu_sc0007596.1_g000001

Essential subunit of the N-oligosaccharyl transferase (OST) complex which catalyzes the transfer of a high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an Asn-X-Ser Thr consensus motif in nascent polypeptide chains

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007596.1
Physical Location & Seq
Reverse (-)
1162 .. 3450
2289 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007596.1_g000001.1.cds

Sequence Viewer

Length: 366 bp
atggtgaggcattcgtcgtcgtcgtcctctacgagccaggacgcccttgcccttttcaattctctgagatcggcttactccgccactcctaccgctctcaagatcattgatctctatgttggtttcgctgtatccacggctatcatccaggtagtctacatggctcttgttggatcattcccatttaactcttttctctctggagtactctcatgcatagggacagcagtccttgctgtttgcctccgtattcaagtgaacaaagaaaacaaggaatttaaggatttagcaccagagcgggcttttgcagattttgttctctgcaatttggttctgcatttggtgatcatgaatttccttggatga

Protein Analysis

121

Amino Acids

13.07

Weight (kDa)

7.73

Isoelectric Point (pI)

39.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 95, 298
AccI GTMKAC 1 cut(s) 156
AciI CCGC 3 cut(s) 81, 93, 298
AclWI GGATC 1 cut(s) 181
AcsI RAATTY 2 cut(s) 275, 352
AcyI GRCGYC 1 cut(s) 42
AfaI GTAC 1 cut(s) 207
AgsI TTSAA 2 cut(s) 58, 254
AjnI CCWGG 2 cut(s) 36, 147
AlwI GGATC 1 cut(s) 181
ApoI RAATTY 2 cut(s) 275, 352
AsuHPI GGTGA 2 cut(s) 16, 355
BceAI ACGGC 1 cut(s) 153
BciT130I CCWGG 2 cut(s) 38, 149
BciVI GTATCC 1 cut(s) 142
BclI TGATCA 1 cut(s) 345
BfuI GTATCC 1 cut(s) 142
BmcAI AGTACT 1 cut(s) 207
Bme1390I CCNGG 2 cut(s) 38, 149
BmrFI CCNGG 2 cut(s) 38, 149
BoxI GACNNNNGTC 1 cut(s) 227
BpmI CTGGAG 1 cut(s) 222
BpuEI CTTGAG 1 cut(s) 83
BsaHI GRCGYC 1 cut(s) 42
BsaJI CCNNGG 2 cut(s) 135, 358
BseBI CCWGG 2 cut(s) 38, 149
BseDI CCNNGG 2 cut(s) 135, 358
BseGI GGATG 1 cut(s) 144
BseMII CTCAG 1 cut(s) 56
BslFI GGGAC 1 cut(s) 235
BsmFI GGGAC 1 cut(s) 235
BsmI GAATGC 1 cut(s) 10
Bsp143I GATC 5 cut(s) 68, 102, 109, 173, 345
BspACI CCGC 3 cut(s) 81, 93, 298
BspCNI CTCAG 1 cut(s) 57
BspHI TCATGA 1 cut(s) 348
BspPI GGATC 1 cut(s) 181
BsrBI CCGCTC 2 cut(s) 95, 298
BssECI CCNNGG 2 cut(s) 135, 358
BssMI GATC 5 cut(s) 68, 102, 109, 173, 345
BssNI GRCGYC 1 cut(s) 42
BssT1I CCWWGG 1 cut(s) 358
Bst2UI CCWGG 2 cut(s) 38, 149
BstACI GRCGYC 1 cut(s) 42
BstAPI GCANNNNNTGC 1 cut(s) 233
BstC8I GCNNGC 1 cut(s) 300
BstDEI CTNAG 1 cut(s) 65
BstDSI CCRYGG 1 cut(s) 135
BstF5I GGATG 1 cut(s) 144
BstKTI GATC 5 cut(s) 71, 105, 112, 176, 348
BstMBI GATC 5 cut(s) 68, 102, 109, 173, 345
BstMWI GCNNNNNNNGC 2 cut(s) 80, 233
BstNI CCWGG 2 cut(s) 38, 149
BstPAI GACNNNNGTC 1 cut(s) 227
BstSCI CCNGG 2 cut(s) 36, 147
BsuI GTATCC 1 cut(s) 142
BtgI CCRYGG 1 cut(s) 135
BtsCI GGATG 1 cut(s) 144
Cac8I GCNNGC 1 cut(s) 300
CciI TCATGA 1 cut(s) 348
CseI GACGC 1 cut(s) 50
Csp6I GTAC 1 cut(s) 206
CviAII CATG 3 cut(s) 160, 213, 349
CviJI RGCY 5 cut(s) 36, 74, 140, 164, 302
CviKI_1 RGCY 5 cut(s) 36, 74, 140, 164, 302
CviQI GTAC 1 cut(s) 206
DdeI CTNAG 1 cut(s) 65
DpnI GATC 5 cut(s) 70, 104, 111, 175, 347
DpnII GATC 5 cut(s) 68, 102, 109, 173, 345
EciI GGCGGA 1 cut(s) 70
Eco130I CCWWGG 1 cut(s) 358
EcoRII CCWGG 2 cut(s) 36, 147
EcoT14I CCWWGG 1 cut(s) 358
EcoT22I ATGCAT 1 cut(s) 218
ErhI CCWWGG 1 cut(s) 358
FaeI CATG 3 cut(s) 163, 216, 352
FaiI YATR 5 cut(s) 117, 161, 214, 218, 350
FaqI GGGAC 1 cut(s) 235
FatI CATG 3 cut(s) 159, 212, 348
FauI CCCGC 1 cut(s) 291
FbaI TGATCA 1 cut(s) 345
FblI GTMKAC 1 cut(s) 156
FokI GGATG 1 cut(s) 131
GsuI CTGGAG 1 cut(s) 222
HgaI GACGC 1 cut(s) 50
Hin1I GRCGYC 1 cut(s) 42
Hin1II CATG 3 cut(s) 163, 216, 352
HphI GGTGA 2 cut(s) 16, 355
Hpy166II GTNNAC 2 cut(s) 157, 259
Hpy188I TCNGA 1 cut(s) 66
Hpy188III TCNNGA 3 cut(s) 100, 201, 349
Hpy8I GTNNAC 2 cut(s) 157, 259
Hpy99I CGWCG 3 cut(s) 19, 22, 25
HpyCH4V TGCA 4 cut(s) 216, 308, 324, 337
HpyF10VI GCNNNNNNNGC 2 cut(s) 80, 233
HpyF3I CTNAG 1 cut(s) 65
Hsp92I GRCGYC 1 cut(s) 42
Hsp92II CATG 3 cut(s) 163, 216, 352
Ksp22I TGATCA 1 cut(s) 345
Kzo9I GATC 5 cut(s) 68, 102, 109, 173, 345
LpnPI CCDG 6 cut(s) 23, 50, 134, 161, 186, 306
MalI GATC 5 cut(s) 70, 104, 111, 175, 347
MbiI CCGCTC 2 cut(s) 95, 298
MboI GATC 5 cut(s) 68, 102, 109, 173, 345
MluCI AATT 4 cut(s) 58, 275, 325, 352
MmeI TCCRAC 1 cut(s) 151
MnlI CCTC 2 cut(s) 37, 254
Mph1103I ATGCAT 1 cut(s) 218
MseI TTAA 2 cut(s) 186, 279
MspR9I CCNGG 2 cut(s) 38, 149
Mva1269I GAATGC 1 cut(s) 10
MvaI CCWGG 2 cut(s) 38, 149
MwoI GCNNNNNNNGC 2 cut(s) 80, 233
NdeII GATC 5 cut(s) 68, 102, 109, 173, 345
NlaIII CATG 3 cut(s) 163, 216, 352
NsiI ATGCAT 1 cut(s) 218
PagI TCATGA 1 cut(s) 348
PcsI WCGNNNNNNNCGW 2 cut(s) 20, 29
PctI GAATGC 1 cut(s) 10
PshAI GACNNNNGTC 1 cut(s) 227
Psp6I CCWGG 2 cut(s) 36, 147
PspGI CCWGG 2 cut(s) 36, 147
RsaI GTAC 1 cut(s) 207
RsaNI GTAC 1 cut(s) 206
SaqAI TTAA 2 cut(s) 186, 279
Sau3AI GATC 5 cut(s) 68, 102, 109, 173, 345
ScaI AGTACT 1 cut(s) 207
ScrFI CCNGG 2 cut(s) 38, 149
SetI ASST 1 cut(s) 153
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 4 cut(s) 58, 275, 325, 352
SsiI CCGC 3 cut(s) 81, 93, 298
StyD4I CCNGG 2 cut(s) 36, 147
StyI CCWWGG 1 cut(s) 358
TasI AATT 4 cut(s) 58, 275, 325, 352
TatI WGTACW 1 cut(s) 205
Tru1I TTAA 2 cut(s) 186, 279
Tru9I TTAA 2 cut(s) 186, 279
TspDTI ATGAA 1 cut(s) 365
TspGWI ACGGA 1 cut(s) 236
XapI RAATTY 2 cut(s) 275, 352
XmiI GTMKAC 1 cut(s) 156
ZrmI AGTACT 1 cut(s) 207
Zsp2I ATGCAT 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.