Rorug05G0501500

Essential subunit of the N-oligosaccharyl transferase (OST) complex which catalyzes the transfer of a high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an Asn-X-Ser Thr consensus motif in nascent polypeptide chains

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
68254373 .. 68254588
216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0501500.1

Sequence Viewer

Length: 216 bp
ATGGAAAAGAAGGGCTGTTCTCCTAATGGCTGGACCTATAACACAATTATCCGAGGGTTGATTAATAACAATGAGACATCATGGGCTATGGGACTTATTCAAGAAATGGTTGAGAGGGGTTTCTTTGTAGATGCATCAACTATGGAATTGATAATTGGTTTATTGTCTAAGGATATAGTAGATCCTGCTTTGTTGCCGTTGTTAAAAGATTCATGA

Protein Analysis

71

Amino Acids

7.9

Weight (kDa)

4.61

Isoelectric Point (pI)

10.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 1 - 21 1e-05 PPR repeat family
PPR_1 PF12854 4 - 37 4e-07 PPR repeat
PPR PF01535 11 - 41 2.4e-06 PPR repeat
PPR_2 PF13041 12 - 54 9e-08 PPR repeat family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 176
AgsI TTSAA 1 cut(s) 101
AjuI GAANNNNNNNTTGG 2 cut(s) 138, 170
Alw26I GTCTC 1 cut(s) 68
AlwI GGATC 1 cut(s) 176
AseI ATTAAT 1 cut(s) 63
AspS9I GGNCC 1 cut(s) 33
AvaII GGWCC 1 cut(s) 33
BceAI ACGGC 1 cut(s) 181
BcoDI GTCTC 1 cut(s) 68
Bme18I GGWCC 1 cut(s) 33
BmgT120I GGNCC 1 cut(s) 33
BmsI GCATC 2 cut(s) 121, 143
BsaJI CCNNGG 1 cut(s) 52
BseDI CCNNGG 1 cut(s) 52
BslFI GGGAC 1 cut(s) 105
BsmAI GTCTC 1 cut(s) 68
BsmFI GGGAC 1 cut(s) 105
Bsp143I GATC 1 cut(s) 181
BspHI TCATGA 1 cut(s) 212
BspPI GGATC 1 cut(s) 176
BssECI CCNNGG 1 cut(s) 52
BssMI GATC 1 cut(s) 181
BstDEI CTNAG 1 cut(s) 168
BstKTI GATC 1 cut(s) 184
BstMAI GTCTC 1 cut(s) 68
BstMBI GATC 1 cut(s) 181
BstX2I RGATCY 1 cut(s) 181
BstYI RGATCY 1 cut(s) 181
CciI TCATGA 1 cut(s) 212
Cfr13I GGNCC 1 cut(s) 33
CviAII CATG 2 cut(s) 81, 213
CviJI RGCY 3 cut(s) 15, 30, 86
CviKI_1 RGCY 3 cut(s) 15, 30, 86
DdeI CTNAG 1 cut(s) 168
DpnI GATC 1 cut(s) 183
DpnII GATC 1 cut(s) 181
Eco47I GGWCC 1 cut(s) 33
EcoT22I ATGCAT 1 cut(s) 136
FaeI CATG 2 cut(s) 84, 216
FaiI YATR 6 cut(s) 39, 82, 89, 143, 176, 214
FaqI GGGAC 1 cut(s) 105
FatI CATG 2 cut(s) 80, 212
Hin1II CATG 2 cut(s) 84, 216
HinfI GANTC 1 cut(s) 209
Hpy188I TCNGA 1 cut(s) 53
Hpy188III TCNNGA 2 cut(s) 101, 213
HpyAV CCTTC 1 cut(s) 4
HpyCH4V TGCA 1 cut(s) 134
HpyF3I CTNAG 1 cut(s) 168
Hsp92II CATG 2 cut(s) 84, 216
Kzo9I GATC 1 cut(s) 181
LpnPI CCDG 2 cut(s) 16, 198
LweI GCATC 2 cut(s) 121, 143
MalI GATC 1 cut(s) 183
MboI GATC 1 cut(s) 181
MflI RGATCY 1 cut(s) 181
MluCI AATT 3 cut(s) 45, 146, 153
MnlI CCTC 2 cut(s) 47, 108
Mph1103I ATGCAT 1 cut(s) 136
MseI TTAA 2 cut(s) 63, 203
NdeII GATC 1 cut(s) 181
NlaIII CATG 2 cut(s) 84, 216
NsiI ATGCAT 1 cut(s) 136
PagI TCATGA 1 cut(s) 212
PfeI GAWTC 1 cut(s) 209
PshBI ATTAAT 1 cut(s) 63
PspPI GGNCC 1 cut(s) 33
PsuI RGATCY 1 cut(s) 181
SaqAI TTAA 2 cut(s) 63, 203
Sau3AI GATC 1 cut(s) 181
Sau96I GGNCC 1 cut(s) 33
SetI ASST 1 cut(s) 38
SfaNI GCATC 2 cut(s) 121, 143
SgeI CNNG 5 cut(s) 43, 65, 93, 113, 197
SinI GGWCC 1 cut(s) 33
Sse9I AATT 3 cut(s) 45, 146, 153
TasI AATT 3 cut(s) 45, 146, 153
TfiI GAWTC 1 cut(s) 209
Tru1I TTAA 2 cut(s) 63, 203
Tru9I TTAA 2 cut(s) 63, 203
TspDTI ATGAA 1 cut(s) 201
VpaK11BI GGWCC 1 cut(s) 33
VspI ATTAAT 1 cut(s) 63
Zsp2I ATGCAT 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.