Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008251.1

Orthogroup ID

OG0007214

Physical Location & Seq

Genomic Coordinates Forward (+)

4430 .. 10893

Gene Structure 6464 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008251.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2385 bp

atggcgtcggagcctcttcgcaccaccacgaccgccgccgaaaaagagaaacggcaccgttccatcttcgaactcccggccaacttcttcgactcctgcgccctcctcacttcttctggcctctcagttgcttcaactttcgagacctctaacaacagcaacaactccgccctcgaaaccctagacgagtctgtgtccgataacaccgatcaagaccgctccctaaacgccgccgtatcgactcggtggacctgcaacacttgcaaggctgagttcgagtccctccaagagcagcgatttcacttcaaatccgatattcaccgattcaatgatattcaagagctacttgctgcatggaagccttattttgatgcttcgtcttgcgtttttgtttatgctccttctagtaatcatcagctgctatctaatagggagacaccgtattttagtcatcagaaagtccgaaatattccaatccctattcggagacctactatgaaggaagctcggcggatatatgaacagttgacacaagtctcttatgaacaagaggagaatgaagctcctttagttaccaaaaaggaattgccgtctagttcaggaattgaaaatgatatcatctcaagcatggcgaaagtcaacattgttgagccttttgttgagcctagtacagaagcttgctcaagtactagagagtccaatgaactccctatatcaagtgagagtagtaatgaggttaagggttcgtcaacacctttgcatgaggcagcacagtctgggaatgctctcaaggttttggaactcttggaacagggtttggatccttgtgccagagatgaaaggggacagactccatacacggtagcaaacgaaaaggaggtcagaaacacatttagacggttcatggcctcaaatctagataagtgggattggaatgctgctaaggtacctagtgcattgacaaaggagatggaggaatctcaagctgctaagcaggctgaaaaagaagcgaaaaggaaagctaaagcaaaagaattgaagaaactacgcaaagaaaaagaaaagaaagctcaggctgaggctgctgcttccaagaatacttcgaccattacaaagtcctcttcatcatctcagcccagtcgtgcatcacagatctctaaagaggaggaactgaaaagggccctggtagccgagagggaaaaacgagcagccgcagccgagcagagaatggctgcagctgcagcccttagtgctcaaggtaatagcaccactccacaacccaaaactggggaagctagtgaaattaactgctcttgttgtaatgtgtctctggctggatctgaaggtggcgatggtggctgtggctatggtccaagtgatgctaatggcggtggtaccagggatggtgggggtggtggtggtgttagtggcaagttagtgatgacgacaaagatgatcacgggggcaaggacaatggtagtggcaggggttggtggtgatggctttagggattttggctattatcatcaaattttggaaataacgggggcaatgacaatggtagtggcaggggttggtggtgatggctttagggattttggctattatcatcaaattttggaaataacgggggcaatgacaatggtagtggcaggggttggtggtgatggctttagggattttggctattatcatcaaattttggaaataacgggggcaatgacaatggtagtggcaggggttggtggtgatggctttagggattttggctattatcatcaaattttggaaataacgggggcaatgacaatggtagtggcaggggttggtggtgatggctttagggattttggctattatcatcaaattttggaaataacgggggcaatgacaatggtagtggcaggggttggtggtgatggctttagggattttggctattatcatcaaattttggaaataacgggggcaatgacaatggtagtggcaggggttgagtctgcagcttccaagactatttcgatgatttcaaagtcctcttcatcatctcatcctagtcgtggatcacagatctctaaagaggaggaactgaaaagggcactggcaaccgagagggaaaaacgagcagccgcagccgagcggagaatggctgcagctgcagcccttagtgctcaaggtaatagcaccactccacaacccaaaactggggaagctggtgaaggtgccgatggtggttgtggctatggtccaagtgatgctaatggcggtggtgccagggatggtggtggtggtggtggtcgtgttagtggcaaattagtgatgataattgtggtggtcacaacgatggctctcaagtggtggcagtggcgacgcagacgacaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

794

Amino Acids

85.23

Weight (kDa)

6.12

Isoelectric Point (pI)

45.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007214)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G01930
fragaria_vesca	FvH4_7g12110 FvH4_7g12110 FvH4_7g12110 FvH4_7g12110 FvH4_7g12110 FvH4_7g12110 FvH4_7g12110
malus_domestica	MD02G1201200.v1.1
prunus_persica	Prupe.2G147600_v2.0.a1 Prupe.2G147600_v2.0.a1
pyrus_communis	pycom02g16460
rosa_chinensis	RchiOBHm_Chr1g0350861
rosa_laevigata	RLG00000028448
rosa_multiflora	Rmu_sc0006200.1_g000008 Rmu_sc0006200.1_g000010 Rmu_sc0008251.1_g000001 Rmu_sc0014584.1_g000013
rosa_roxburghii	Rroxscaffold_4G00304460
rosa_rugosa	Rorug01G0214700
rosa_samantha	Rh1AG229100 Rh1BG199100 Rh1CG213900 Rh1DG227000
rosa_wichuraiana	Rw1G019850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	260
Acc65I	GGTACC	2 cut(s)	946, 1394
AccB1I	GGYRCC	5 cut(s)	54, 946, 1394, 2222, 2270
AccBSI	CCGCTC	2 cut(s)	219, 2140
AclWI	GGATC	4 cut(s)	815, 828, 1345, 2071
AcoI	YGGCCR	1 cut(s)	78
AcsI	RAATTY	6 cut(s)	1530, 1614, 1698, 1782, 1866, 1950
AcuI	CTGAAG	1 cut(s)	1362
AcyI	GRCGYC	1 cut(s)	5
AfaI	GTAC	4 cut(s)	670, 688, 948, 1396
AfiI	CCNNNNNNNGG	5 cut(s)	1286, 1287, 2060, 2204, 2205
AgsI	TTSAA	7 cut(s)	135, 307, 328, 338, 608, 1039, 2031
AjnI	CCWGG	3 cut(s)	1182, 1397, 2273
Alw21I	GWGCWC	2 cut(s)	1255, 2173
Alw26I	GTCTC	5 cut(s)	137, 428, 481, 541, 1332
AlwI	GGATC	4 cut(s)	815, 828, 1345, 2071
AoxI	GGCC	4 cut(s)	78, 118, 906, 1179
ApaI	GGGCCC	1 cut(s)	1183
ApoI	RAATTY	6 cut(s)	1530, 1614, 1698, 1782, 1866, 1950
ArsI	GACNNNNNNTTYG	2 cut(s)	864, 896
Asp718I	GGTACC	2 cut(s)	946, 1394
AspLEI	GCGC	1 cut(s)	101
AspS9I	GGNCC	5 cut(s)	249, 1179, 1180, 1370, 2246
AsuC2I	CCSGG	1 cut(s)	77
AsuHPI	GGTGA	8 cut(s)	311, 1508, 1592, 1676, 1760, 1844, 1928, 2228
AsuII	TTCGAA	1 cut(s)	69
AvaII	GGWCC	3 cut(s)	249, 1370, 2246
BaeGI	GKGCMC	2 cut(s)	1183, 2101
BamHI	GGATCC	1 cut(s)	820
BanI	GGYRCC	5 cut(s)	54, 946, 1394, 2222, 2270
BanII	GRGCYC	1 cut(s)	1183
Bbv12I	GWGCWC	2 cut(s)	1255, 2173
BbvCI	CCTCAGC	1 cut(s)	1077
BceAI	ACGGC	3 cut(s)	68, 218, 574
BciT130I	CCWGG	3 cut(s)	1184, 1399, 2275
BclI	TGATCA	1 cut(s)	1455
BcnI	CCSGG	1 cut(s)	77
BcoDI	GTCTC	5 cut(s)	137, 428, 481, 541, 1332
BfaI	CTAG	9 cut(s)	182, 405, 594, 666, 690, 917, 951, 1296, 2055
BfmI	CTRYAG	5 cut(s)	1233, 1239, 2001, 2151, 2157
BfuAI	ACCTGC	1 cut(s)	260
BglII	AGATCT	2 cut(s)	1152, 2070
BlpI	GCTNAGC	1 cut(s)	990
BmcAI	AGTACT	1 cut(s)	688
Bme1390I	CCNGG	4 cut(s)	77, 1184, 1399, 2275
Bme18I	GGWCC	3 cut(s)	249, 1370, 2246
BmgT120I	GGNCC	5 cut(s)	249, 1179, 1180, 1370, 2246
BmiI	GGNNCC	8 cut(s)	12, 56, 822, 948, 1181, 1396, 2224, 2272
BmrFI	CCNGG	4 cut(s)	77, 1184, 1399, 2275
BmrI	ACTGGG	3 cut(s)	1131, 1296, 2214
BmsI	GCATC	4 cut(s)	361, 1154, 1369, 2245
BmuI	ACTGGG	3 cut(s)	1131, 1296, 2214
BoxI	GACNNNNGTC	1 cut(s)	533
Bpu10I	CCTNAGC	3 cut(s)	942, 1071, 1077
Bpu1102I	GCTNAGC	1 cut(s)	990
Bpu14I	TTCGAA	1 cut(s)	69
BpuEI	CTTGAG	7 cut(s)	607, 667, 773, 966, 1239, 2157, 2336
BpuMI	CCSGG	1 cut(s)	77
BsaHI	GRCGYC	1 cut(s)	5
BsaI	GGTCTC	2 cut(s)	137, 481
BsaJI	CCNNGG	3 cut(s)	1182, 1398, 2274
BsaXI	ACNNNNNCTCC	2 cut(s)	425, 455
Bsc4I	CCNNNNNNNGG	5 cut(s)	1286, 1287, 2060, 2204, 2205
Bse1I	ACTGG	4 cut(s)	1137, 1291, 2106, 2209
Bse3DI	GCAATG	6 cut(s)	1557, 1641, 1725, 1809, 1893, 1977
BseBI	CCWGG	3 cut(s)	1184, 1399, 2275
BseDI	CCNNGG	3 cut(s)	1182, 1398, 2274
BseGI	GGATG	3 cut(s)	1408, 2050, 2284
BseLI	CCNNNNNNNGG	5 cut(s)	1286, 1287, 2060, 2204, 2205
BseMI	GCAATG	6 cut(s)	1557, 1641, 1725, 1809, 1893, 1977
BseMII	CTCAG	5 cut(s)	138, 261, 1068, 1085, 1145
BseNI	ACTGG	4 cut(s)	1137, 1291, 2106, 2209
BseRI	GAGGAG	4 cut(s)	95, 566, 1178, 2096
BseSI	GKGCMC	2 cut(s)	1183, 2101
Bsh1285I	CGRYCG	1 cut(s)	33
BshFI	GGCC	4 cut(s)	80, 120, 908, 1181
BshNI	GGYRCC	5 cut(s)	54, 946, 1394, 2222, 2270
BsiEI	CGRYCG	1 cut(s)	33
BsiHKAI	GWGCWC	2 cut(s)	1255, 2173
BsiSI	CCGG	1 cut(s)	77
BslFI	GGGAC	2 cut(s)	265, 858
BslI	CCNNNNNNNGG	5 cut(s)	1286, 1287, 2060, 2204, 2205
BsmAI	GTCTC	5 cut(s)	137, 428, 481, 541, 1332
BsmFI	GGGAC	2 cut(s)	265, 858
BsmI	GAATGC	2 cut(s)	787, 940
BsnI	GGCC	4 cut(s)	80, 120, 908, 1181
Bso31I	GGTCTC	2 cut(s)	137, 481
Bsp119I	TTCGAA	1 cut(s)	69
Bsp120I	GGGCCC	1 cut(s)	1179
Bsp1286I	GDGCHC	4 cut(s)	1183, 1255, 2101, 2173
Bsp143I	GATC	7 cut(s)	208, 820, 1152, 1337, 1455, 2063, 2070
Bsp1720I	GCTNAGC	1 cut(s)	990
BspANI	GGCC	4 cut(s)	80, 120, 908, 1181
BspCNI	CTCAG	5 cut(s)	137, 262, 1069, 1084, 1144
BspLI	GGNNCC	8 cut(s)	12, 56, 822, 948, 1181, 1396, 2224, 2272
BspMAI	CTGCAG	5 cut(s)	1237, 1243, 2005, 2155, 2161
BspMI	ACCTGC	1 cut(s)	260
BspPI	GGATC	4 cut(s)	815, 828, 1345, 2071
BspT104I	TTCGAA	1 cut(s)	69
BspT107I	GGYRCC	5 cut(s)	54, 946, 1394, 2222, 2270
BspTNI	GGTCTC	2 cut(s)	137, 481
BsrBI	CCGCTC	2 cut(s)	219, 2140
BsrDI	GCAATG	6 cut(s)	1557, 1641, 1725, 1809, 1893, 1977
BsrI	ACTGG	4 cut(s)	1137, 1291, 2106, 2209
BssECI	CCNNGG	3 cut(s)	1182, 1398, 2274
BssMI	GATC	7 cut(s)	208, 820, 1152, 1337, 1455, 2063, 2070
BssNI	GRCGYC	1 cut(s)	5
Bst2UI	CCWGG	3 cut(s)	1184, 1399, 2275
Bst4CI	ACNGT	6 cut(s)	59, 441, 525, 774, 862, 900
Bst6I	CTCTTC	3 cut(s)	21, 1126, 2044
BstACI	GRCGYC	1 cut(s)	5
BstAPI	GCANNNNNTGC	1 cut(s)	261
BstBI	TTCGAA	1 cut(s)	69
BstC8I	GCNNGC	2 cut(s)	679, 996
BstDEI	CTNAG	9 cut(s)	124, 270, 942, 990, 1071, 1077, 1131, 1247, 2165
BstF5I	GGATG	3 cut(s)	1408, 2050, 2284
BstHHI	GCGC	1 cut(s)	101
BstKTI	GATC	7 cut(s)	211, 823, 1155, 1340, 1458, 2066, 2073
BstMAI	GTCTC	5 cut(s)	137, 428, 481, 541, 1332
BstMBI	GATC	7 cut(s)	208, 820, 1152, 1337, 1455, 2063, 2070
BstMCI	CGRYCG	1 cut(s)	33
BstNI	CCWGG	3 cut(s)	1184, 1399, 2275
BstPAI	GACNNNNGTC	1 cut(s)	533
BstSCI	CCNGG	4 cut(s)	75, 1182, 1397, 2273
BstSFI	CTRYAG	5 cut(s)	1233, 1239, 2001, 2151, 2157
BstSLI	GKGCMC	2 cut(s)	1183, 2101
BstX2I	RGATCY	4 cut(s)	820, 1152, 1337, 2070
BstYI	RGATCY	4 cut(s)	820, 1152, 1337, 2070
BsuRI	GGCC	4 cut(s)	80, 120, 908, 1181
BtgZI	GCGATG	1 cut(s)	1365
BtsCI	GGATG	3 cut(s)	1408, 2050, 2284
BtsI	GCAGTG	1 cut(s)	2369
BtsIMutI	CAGTG	2 cut(s)	2099, 2369
BveI	ACCTGC	1 cut(s)	260
Cac8I	GCNNGC	2 cut(s)	679, 996
CfoI	GCGC	1 cut(s)	101
Cfr13I	GGNCC	5 cut(s)	249, 1179, 1180, 1370, 2246
CseI	GACGC	1 cut(s)	2379
Csp6I	GTAC	4 cut(s)	669, 687, 947, 1395
CviAII	CATG	4 cut(s)	354, 628, 761, 904
CviQI	GTAC	4 cut(s)	669, 687, 947, 1395
DdeI	CTNAG	9 cut(s)	124, 270, 942, 990, 1071, 1077, 1131, 1247, 2165
DpnI	GATC	7 cut(s)	210, 822, 1154, 1339, 1457, 2065, 2072
DpnII	GATC	7 cut(s)	208, 820, 1152, 1337, 1455, 2063, 2070
EaeI	YGGCCR	1 cut(s)	78
Eam1104I	CTCTTC	3 cut(s)	21, 1126, 2044
EarI	CTCTTC	3 cut(s)	21, 1126, 2044
EciI	GGCGGA	2 cut(s)	157, 526
Eco24I	GRGCYC	1 cut(s)	1183
Eco31I	GGTCTC	2 cut(s)	137, 481
Eco32I	GATATC	1 cut(s)	616
Eco47I	GGWCC	3 cut(s)	249, 1370, 2246
Eco57I	CTGAAG	1 cut(s)	1362
EcoO109I	RGGNCCY	2 cut(s)	1179, 1180
EcoRII	CCWGG	3 cut(s)	1182, 1397, 2273
EcoRV	GATATC	1 cut(s)	616
EcoT38I	GRGCYC	1 cut(s)	1183
FaeI	CATG	4 cut(s)	357, 631, 764, 907
FalI	AAGNNNNNCTT	2 cut(s)	330, 362
FaqI	GGGAC	2 cut(s)	265, 858
FatI	CATG	4 cut(s)	353, 627, 760, 903
FbaI	TGATCA	1 cut(s)	1455
FokI	GGATG	3 cut(s)	1415, 2037, 2291
FriOI	GRGCYC	1 cut(s)	1183
FspBI	CTAG	9 cut(s)	182, 405, 594, 666, 690, 917, 951, 1296, 2055
GlaI	GCGC	1 cut(s)	100
HaeIII	GGCC	4 cut(s)	80, 120, 908, 1181
HapII	CCGG	1 cut(s)	77
HgaI	GACGC	1 cut(s)	2379
HhaI	GCGC	1 cut(s)	101
Hin1I	GRCGYC	1 cut(s)	5
Hin1II	CATG	4 cut(s)	357, 631, 764, 907
Hin6I	GCGC	1 cut(s)	99
HinP1I	GCGC	1 cut(s)	99
HincII	GTYRAC	3 cut(s)	528, 640, 750
HindII	GTYRAC	3 cut(s)	528, 640, 750
HindIII	AAGCTT	1 cut(s)	675
HinfI	GANTC	9 cut(s)	92, 188, 241, 278, 324, 695, 850, 977, 1997
HpaII	CCGG	1 cut(s)	77
HphI	GGTGA	8 cut(s)	311, 1508, 1592, 1676, 1760, 1844, 1928, 2228
Hpy166II	GTNNAC	4 cut(s)	249, 528, 640, 750
Hpy188I	TCNGA	8 cut(s)	10, 199, 313, 456, 464, 486, 884, 1342
Hpy188III	TCNNGA	5 cut(s)	142, 212, 338, 600, 917
Hpy8I	GTNNAC	4 cut(s)	249, 528, 640, 750
Hpy99I	CGWCG	2 cut(s)	10, 2373
HpyAV	CCTTC	4 cut(s)	411, 493, 1337, 2213
HpyCH4III	ACNGT	6 cut(s)	59, 441, 525, 774, 862, 900
HpyF3I	CTNAG	9 cut(s)	124, 270, 942, 990, 1071, 1077, 1131, 1247, 2165
Hsp92I	GRCGYC	1 cut(s)	5
Hsp92II	CATG	4 cut(s)	357, 631, 764, 907
HspAI	GCGC	1 cut(s)	99
KpnI	GGTACC	2 cut(s)	950, 1398
Ksp22I	TGATCA	1 cut(s)	1455
Kzo9I	GATC	7 cut(s)	208, 820, 1152, 1337, 1455, 2063, 2070
LmnI	GCTCC	4 cut(s)	10, 224, 403, 568
LweI	GCATC	4 cut(s)	361, 1154, 1369, 2245
MaeI	CTAG	9 cut(s)	182, 405, 594, 666, 690, 917, 951, 1296, 2055
MaeIII	GTNAC	2 cut(s)	571, 2335
MalI	GATC	7 cut(s)	210, 822, 1154, 1339, 1457, 2065, 2072
MbiI	CCGCTC	2 cut(s)	219, 2140
MboI	GATC	7 cut(s)	208, 820, 1152, 1337, 1455, 2063, 2070
MboII	GAAGA	7 cut(s)	8, 58, 79, 105, 1051, 1113, 2031
MflI	RGATCY	4 cut(s)	820, 1152, 1337, 2070
MhlI	GDGCHC	4 cut(s)	1183, 1255, 2101, 2173
MlyI	GAGTC	7 cut(s)	86, 197, 235, 287, 704, 844, 2006
MseI	TTAA	2 cut(s)	738, 1305
MslI	CAYNNNNRTG	1 cut(s)	2342
MspA1I	CMGCKG	3 cut(s)	418, 1238, 2156
MspI	CCGG	1 cut(s)	77
MspR9I	CCNGG	4 cut(s)	77, 1184, 1399, 2275
Mva1269I	GAATGC	2 cut(s)	787, 940
MvaI	CCWGG	3 cut(s)	1184, 1399, 2275
NciI	CCSGG	1 cut(s)	77
NdeII	GATC	7 cut(s)	208, 820, 1152, 1337, 1455, 2063, 2070
NlaIII	CATG	4 cut(s)	357, 631, 764, 907
NlaIV	GGNNCC	8 cut(s)	12, 56, 822, 948, 1181, 1396, 2224, 2272
NmeAIII	GCCGAG	4 cut(s)	487, 1216, 1243, 2161
NmuCI	GTSAC	1 cut(s)	2335
NspV	TTCGAA	1 cut(s)	69
PctI	GAATGC	2 cut(s)	787, 940
PfeI	GAWTC	2 cut(s)	324, 977
PleI	GAGTC	7 cut(s)	86, 196, 235, 286, 703, 844, 2005
PpsI	GAGTC	7 cut(s)	86, 196, 235, 286, 703, 844, 2005
PshAI	GACNNNNGTC	1 cut(s)	533
Psp6I	CCWGG	3 cut(s)	1182, 1397, 2273
PspGI	CCWGG	3 cut(s)	1182, 1397, 2273
PspN4I	GGNNCC	8 cut(s)	12, 56, 822, 948, 1181, 1396, 2224, 2272
PspOMI	GGGCCC	1 cut(s)	1179
PspPI	GGNCC	5 cut(s)	249, 1179, 1180, 1370, 2246
PstI	CTGCAG	5 cut(s)	1237, 1243, 2005, 2155, 2161
PsuI	RGATCY	4 cut(s)	820, 1152, 1337, 2070
PvuII	CAGCTG	3 cut(s)	418, 1238, 2156
RsaI	GTAC	4 cut(s)	670, 688, 948, 1396
RsaNI	GTAC	4 cut(s)	669, 687, 947, 1395
RseI	CAYNNNNRTG	1 cut(s)	2342
SaqAI	TTAA	2 cut(s)	738, 1305
Sau3AI	GATC	7 cut(s)	208, 820, 1152, 1337, 1455, 2063, 2070
Sau96I	GGNCC	5 cut(s)	249, 1179, 1180, 1370, 2246
ScaI	AGTACT	1 cut(s)	688
SchI	GAGTC	7 cut(s)	86, 197, 235, 287, 704, 844, 2006
ScrFI	CCNGG	4 cut(s)	77, 1184, 1399, 2275
SduI	GDGCHC	4 cut(s)	1183, 1255, 2101, 2173
SfaNI	GCATC	4 cut(s)	361, 1154, 1369, 2245
SfcI	CTRYAG	5 cut(s)	1233, 1239, 2001, 2151, 2157
SfuI	TTCGAA	1 cut(s)	69
SinI	GGWCC	3 cut(s)	249, 1370, 2246
SmiMI	CAYNNNNRTG	1 cut(s)	2342
SmlI	CTYRAG	7 cut(s)	622, 682, 788, 981, 1254, 2172, 2351
SmoI	CTYRAG	7 cut(s)	622, 682, 788, 981, 1254, 2172, 2351
SspI	AATATT	1 cut(s)	469
SspMI	CTAG	9 cut(s)	182, 405, 594, 666, 690, 917, 951, 1296, 2055
StyD4I	CCNGG	4 cut(s)	75, 1182, 1397, 2273
TaaI	ACNGT	6 cut(s)	59, 441, 525, 774, 862, 900
TaqI	TCGA	8 cut(s)	69, 90, 141, 174, 239, 276, 1103, 2021
TatI	WGTACW	2 cut(s)	668, 686
TauI	GCSGC	4 cut(s)	38, 233, 1214, 2132
TfiI	GAWTC	2 cut(s)	324, 977
Tru1I	TTAA	2 cut(s)	738, 1305
Tru9I	TTAA	2 cut(s)	738, 1305
TscAI	CASTG	2 cut(s)	2106, 2369
TseFI	GTSAC	1 cut(s)	2335
Tsp45I	GTSAC	1 cut(s)	2335
TspDTI	ATGAA	9 cut(s)	512, 534, 558, 573, 717, 852, 892, 1113, 2031
TspRI	CASTG	2 cut(s)	2106, 2369
VpaK11BI	GGWCC	3 cut(s)	249, 1370, 2246
XapI	RAATTY	6 cut(s)	1530, 1614, 1698, 1782, 1866, 1950
XbaI	TCTAGA	1 cut(s)	916
XspI	CTAG	9 cut(s)	182, 405, 594, 666, 690, 917, 951, 1296, 2055
ZrmI	AGTACT	1 cut(s)	688

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.